Previous Year Questions

QUESTION ID:2

Suppose a tap mixes hot water and cold water in a ratio that depends linearly on the proportion of opening. Water out of the tap has temperature 40°C when the tap is half-open, and 30°C when it is three-fourths open. To get water at 50°C, the tap should be ______.

QUESTION ID:3

With a certain set of diameters, a tractor’s front wheels make 2 revolutions (revs) for every 1 revolution of the rear wheels. The effect of changing wheel diameter(s) is shown in the following plot.

In this context, which of the following statements is CORRECT?

QUESTION ID:4

Numbers of seats for Mathematics, Physics and Biology in a college are in the ratio 2 : 3 : 4. What will be the respective ratio if the seats for each subject are increased by 50%?

QUESTION ID:5

Restaurants A, B, C, and D give the following offers:

A: one mocktail free for every two purchased
B: one mocktail free for every three purchased
C: two mocktails free for every six purchased
D: 30% discount on each mocktail

If all of the restaurants have the same marked price for each mocktail, in which restaurant would you pay the least if you drank eight mocktails?

QUESTION ID:6

Suppose the words GATE, FAST, SAND and READ can be written in numbers as 2938, 6921, 0798 and 5917, but not necessarily in that order. The positions of the letters in a word and the corresponding digits in the respective number are the same. Then the word NEGATE will be written as

QUESTION ID:7

The following bus schedule is seen at a bus stop located somewhere in between town A and town B.

Town A: 00:10, then every 20 mins
Town B: 00:15, then every 20 mins

If a person arrives at this bus stop at some random time, the probability that the next bus is for town B is:

QUESTION ID:8

Consider the following information regarding a 3-digit PIN.

QUESTION ID:9

The unit’s place digit is half the ten’s place digit in a two-digit number N. If we swap the digits, the number gets reduced by 18. The number N is ______.

QUESTION ID:10

The Sankey diagram shows food preferences of males and females. The widths of the bands are proportional to numbers of persons opting for a given food item.

Which one of the following is an INCORRECT statement about the food preferences?

QUESTION ID:11

A cellphone tower with signals reaching up to 500 m is set up on a conical hill of height 1.5 km and base radius 2 km. Assuming the tower’s height to be negligible compared to the hill, the area served by the tower in km² is (the area of the curved surface of a right circular cone is π × base radius × slant height)*.

QUESTION ID:12

There is an increase of 30% in the number of people coming to a theatre after reducing the entry fee by 25% per person. How much change is expected in the total earnings?

QUESTION ID:13

With only one match, between teams B and C, remaining in a tournament where each win fetches two points and a loss none, team A observes that they will become champions with more points than any other team if B wins, but not necessarily if B loses. Then,

QUESTION ID:14

The pie charts show placement percentages of graduates of five different subjects out of the total campus placements for two consecutive years.

In the year 2024, the number of Maths students who got placed was double that of the previous year. Which of the following is the closest to the percentage change in the number of Life Sciences students placed in the year 2024?

QUESTION ID:15

The following ternary figure shows the marks obtained by students A, B and C in an exam of 100 marks. Here, C received 10 marks in Physics, 50 marks in Chemistry and 40 marks in Mathematics.

Which one of the following is CORRECT?

QUESTION ID:16

A boatman on a bank of a river has to carry a dog, a cat and a container full of milk to the other bank in a boat, one at a time. The cat cannot be left alone with the milk or with the dog on either bank. What is the minimum number of times the boatman has to cross the river to carry all to the other bank?

QUESTION ID:17

Sachin sees one-fourth of his body (height) when he stands in front of a vertical mirror at a distance of 20 cm from it. How much of his body will he see if he steps back and stands 40 cm from the mirror?

QUESTION ID:18

A father said to his son, “I was as old as you are when I became your father.” If the current age of the father is 52 years, the age of the son after 10 years will be _____.

QUESTION ID:19

A box contains 20 black, 22 white, and 24 red socks. If a person draws socks at random one by one without looking, what is the minimum number of socks she must pick to be certain of having at least one pair of black socks?

QUESTION ID:20

An auditorium has 8 seats in the first row, with every row to follow having 4 more seats than its preceding row. The total capacity is 416. What is the minimum number of rows needed to seat 150 people?

QUESTION ID:21

Which one of the following options represents the correct order of events during new limb regeneration following amputation?

QUESTION ID:22

An antibiotic, that mimics aminoacyl-tRNAs, gets incorporated into the polypeptide chain and prematurely terminates elongation.

The following statements are made based on this observation:

A. It enters the ribosome through the A-site.
B. It enters the ribosome through the P-site.
C. A part of its structure resembles the carboxy terminus of amino acids and is available for making a peptide bond.
D. A part of its structure resembles the amino terminus of amino acids and is available for making a peptide bond.

Which one of the following options represents all correct statements?

QUESTION ID:23

Which one of the following is NOT an evolutionary model for mate choice in animals?

QUESTION ID:24

Assimilation Efficiency is calculated as the percentage of the ingested energy that is assimilated by an organism. Which one of the following gut architectures has the lowest assimilation efficiency?

QUESTION ID:25

Which key feature best differentiates somatic embryogenesis from organogenesis in plant tissue culture?

QUESTION ID:26

Which one of the following is NOT caused by atriopeptins, a family of peptides produced in cardiac atrial tissues?

QUESTION ID:27

Given below are pairs of sugars.

A. D-glucose and D-fructose
B. D-galactose and D-glucose
C. α-D-glucose and β-D-glucose
D. D-ribose and D-ribulose

Which one of the following options represents the correct combination of anomer and epimer pairs, respectively?

QUESTION ID:28

Which one of the following statements is INCORRECT about the phylogenetic species concept?

QUESTION ID:29

The cytosolic proteins, Ras and Rab, are anchored to the cytosolic face of the plasma membrane by prenylation. Prenylation typically occurs at which amino acid of the protein?

QUESTION ID:30

Which one of the following pairs is NOT a prokaryote : angiosperm symbiotic pair that can fix atmospheric nitrogen?

QUESTION ID:31

Which one of the following options is the correct sequence of gene expression for successful axis specification in Drosophila?

QUESTION ID:32

New protein-coding genes sometimes originate when exons from different ancestral genes are combined through recombination events, producing a novel domain architecture within a single polypeptide. This mechanism of generating new genes is called:

QUESTION ID:33

Which one of the following options represents a set of bird species, all of which are found ONLY in India?

QUESTION ID:34

The circadian rhythm of higher vertebrates is regulated by the

QUESTION ID:35

The resource-ratio hypothesis (R* ) of competitive coexistence of species proposed by David Tilman postulates that

QUESTION ID:36

In the complete blood profile analysis using an automated haematology analyser, the haemoglobin concentration is measured using

QUESTION ID:37

Which one of the following animals normally exhibit reflex ovulation?

QUESTION ID:38

Which one of the following enzymes catalyzes the biochemical reaction given below? (DROP)

QUESTION ID:39

Which one of the following is NOT involved in the secretion of K⁺ from blood into the tubular fluid by the principal cells of distal tubules?

QUESTION ID:40

Yeast gene Y has an mRNA with the structure shown below. Both the upstream open reading frame (uORF) and the coding region of gene Y have start and stop codons.

Which one of the following will you remove to maximize translation of gene Y?

QUESTION ID:41

Sulfur taken by plant roots from the soil undergoes major changes in the oxidation state as it converts from inorganic to biochemically available form. Which one of the following options represents the correct order of the conversion states of sulfur?

QUESTION ID:42

Which one of the following is NOT a disease caused by a virus?

QUESTION ID:43

A polydactyly allele shows 60% penetrance and variable expressivity. What would you expect to observe in a family carrying this allele?

QUESTION ID:44

Which one of the following histone marks is NOT an indicator of heterochromatin?

QUESTION ID:45

Which one of the following light treatments (L, light; D, dark) promotes flowering in short-day plants?

QUESTION ID:46

During long-term growth in static liquid culture, Pseudomonas fluorescens diversifies into distinct colony types with the following characteristics: wrinkly spreaders that form biofilms at the oxygen-rich surface, smooth morphs that grow freely in the oxygen-poor bottom layer, and fuzzy types that colonise the intermediate zone.

Which one of the following evolutionary processes best explains this ecological diversification?

QUESTION ID:47

In developing mouse brain, when gene yfg is deleted from hippocampal cell-type ‘A’, the number of neighbouring cell-type ‘B’ increases by five-fold. From this information, which one of the following statements accurately describes yfg functioning in wildtype ‘A’ cells?

QUESTION ID:48

Which one of the following statements correctly describes the role of Proliferating Cell Nuclear Antigen (PCNA) in eukaryotic DNA replication?

QUESTION ID:49

Which one of the enzymatic activities is NOT present in bacterial RecA?

QUESTION ID:50

Which one of the following pairs is analogous and NOT homologous?

QUESTION ID:51

Given below is one of the strands of a double-stranded DNA sequence:

5′ – ATGCGATGACGATGACGATGACGATGACGAACGATGAGATGG – 3′

In the absence of any other confounding factors (viz., length, Tm, etc.), which one of the following options represents the primer combination that would amplify the above double-stranded template in a PCR?

QUESTION ID:52

Which one of the following molecules does NOT directly transduce signals to neighbouring cells?

QUESTION ID:53

Two different antibodies against the same protein were generated. They were named AB1 and AB2. While AB1 was able to detect the target protein in a western blot, it was unable to detect the protein in ELISA. The opposite was true for AB2. Which one of the following is the most likely reason?

QUESTION ID:54

Which one of the following corresponds to the angle of rotation per residue in a 3₁₀ helix and 3.6₁₃ helix, respectively?

QUESTION ID:55

Gradualism and punctuated equilibrium represent contrasting models of evolutionary change. Which one of the following options best describes these two models?

QUESTION ID:56

Which one of the following components of the immune system is NOT effective for the clearance of large parasites like worms?

QUESTION ID:57

Which one of the following statements is FALSE regarding how retroviruses and DNA viruses can lead to cancer in host cells?

QUESTION ID:58

Which one of the following statements is NOT considered a core principle of conservation biology?

QUESTION ID:59

Which one of the following options is a correct match of plant selection marker genes used for genetic transformation and their properties?

QUESTION ID:60

Most transposable elements contain flanking terminal inverted repeats. Which one of the following options is INCORRECT pertaining to these repeats?

QUESTION ID:61

A C₃ plant is shifted from 25 °C to 40 °C under full sunlight. Which one of the following is most likely to happen?

QUESTION ID:62

Which one of the following is the most appropriate effect of hypoxic pretreatment and acclimation on the survival of plants under anoxia?

QUESTION ID:63

Lac repressor binding occurs at the level of

QUESTION ID:64

A cross is made between two strains of E. coli, Hfr leu⁺ arg⁺ met⁺ × F^- leu^- arg^- met^- Str^R, and the mixture is plated on minimal synthetic medium supplemented with streptomycin, arginine and methionine. If the linear organization of the genes is leu–arg–met, which one of the following genotypes is expected to occur with lowest frequency?

QUESTION ID:65

The genome editing tool CRISPR–Cas9 was developed based on which one of the following natural phenomena?

QUESTION ID:66

Which one of the following options is NOT included in the Wildlife (Protection) Amendment Act, 2022?

QUESTION ID:67

Which one of the following metabotropic receptors increases intracellular cAMP level after stimulation by its specific neurotransmitter?

QUESTION ID:68

Which one of the following vitamins contains a transition metal ion as a part of its structure?

QUESTION ID:69

Which one of the following events are likely to result in delayed or defective cytokinesis?

QUESTION ID:70

Choose the INCORRECT statement regarding the synthesis of reactive oxygen species (ROS) upon pathogen infection in plants.

QUESTION ID:71

A B6 mouse (H-2b haplotype) was crossed with a CBA mouse (H-2k haplotype) to generate F1 progeny. The following skin transplant experiments were then performed:

A. Graft from B6 mouse to CBA mouse
B. Graft from F1 mouse to B6 parent
C. Graft from F1 mouse to CBA parent
D. Graft from F1 mouse to F1 mouse
E. Graft from B6 mouse to F1 mouse

Which one of the following options represents all recipients in which the graft is tolerated?

QUESTION ID:72

The following constructs, A or B, have been introduced into two different cultures of eukaryotic cells.

Cre recombinase can act upon loxP–loxP and loxN–loxN sites. The following outcomes have been predicted on the types of fluorescence emitted by the cells upon induction of Cre-recombinase:

A. The cells transfected with construct A will yield three types of cells: each type expressing either red or green or yellow fluorescence.
B. The cells transfected with construct B will yield three types of cells: each type expressing either red or green or yellow fluorescence.
C. The cells transfected with construct A will yield two types of cells: each type expressing either red or green fluorescence.
D. The cells transfected with construct B will yield two types of fluorescent cells: each type expressing either red or yellow fluorescence.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:73

Conjugation experiments were performed by mixing four different auxotrophic strains (P, Q, R and S) of E. coli in different combinations. The generation of prototrophs in each of these combinations on appropriate minimal selection media is given below:

Based on the above data, the following statements were made:

A. Strains P and R are F^- strains.
B. Strain Q is a F⁺ strain.
C. Strain S is a Hfr strain.
D. Strains P and R are F⁺ and F^- strains, respectively.
E. Strains P and R are both Hfr strains.

Which one of the following options represents a combination of all correct statements?

QUESTION ID:74

The following statements were made regarding cell fate specification of trophoblast and inner cell mass (ICM) during mammalian embryogenesis:

A. Oct4 represses Cdx2 expression, enabling some cells to become ICM.
B. Cdx2 synthesized by the trophoblast cells activates Oct4 and Nanog.
C. Expression of Nanog allows cells of the ICM to retain their pluripotency.
D. YAP binds to TEAD4 and represses Cdx2 in the trophoblast cells.

Which one of the following options correctly represent events that determine the fate of trophoblasts and ICM?

QUESTION ID:75

A certain trait in a species is governed by variation at the AB locus that has two alleles (A, B) that give rise to three genotypes, AA, AB and BB. A sample of 1000 individuals of the species were genotyped and the data is given in the table below:

QUESTION ID:76

The following statements are made regarding phenolic biosynthesis in plants.

A. The lignans and flavonoids have abundant methylated carboxyl groups, compared to methylated hydroxyl groups.
B. Cells producing lignans and flavonoids have a very high demand for S-adenosylmethionine.
C. The majority of methylation reactions involved in the formation of phenolics are catalyzed by O-methyltransferases.
D. The catechol-O-methyltransferase (COMT) has strict substrate specificity.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:77

Rhododendron arboreum of the family Ericaceae represents one of the ancient tree species of the genus showing extreme disjunction in the Indian subcontinent. It is represented by two sub-species, viz., ssp. arboreum Smith in the forests of north-eastern India (temperate) and spp. nilagiricum distributed in the southern Western Ghats (tropical) of India with no distribution in the intervening plains.

The following are some of the biogeographical theories that explain distribution of flora and fauna in the Indian subcontinent:

A. Island biogeography theory – The mountains function as isolated islands, promoting speciation.
B. Satpura Hypothesis – Species migrated between the Himalayas and the Western Ghats along a cooler, wetter corridor formed by the Satpura mountain range during periods of glacial expansion.
C. The Noah’s Ark hypothesis / ‘Out of India’ hypothesis – The Indian subcontinent is a remnant of the ancient supercontinent Gondwana, that acted as an isolated “ark” for millions of years, giving rise to some modern plant and mammalian groups.

Which one of the combinations of biogeographical models explain the distribution of R. arboreum?

QUESTION ID:78

In a polluted aquatic environment, bacteria are chronically exposed to low concentrations of multiple antibiotics released from pharmaceutical effluents. Over time, resistant colonies appear even when the antibiotic concentration remains constant. To determine whether resistance arises through induced mutation (a physiological response to antibiotics) or random mutation followed by selection, an ecologist performs a fluctuation test similar to that of Luria and Delbrück (1943) using replicate bacterial cultures.

Which one of the following outcomes would best support the conclusion that antibiotic resistance arises by random mutation followed by selection, rather than by induction?

QUESTION ID:79

Antibiotic resistant strains of various pathogenic bacteria are a serious concern for human health. The following table has the names of important bacteria (Column X), specific strains of which can cause serious illnesses (Column Y).

QUESTION ID:80

The table below gives different eras (Column X) and periods of the geological time scale (Column Y).

QUESTION ID:81

Given below are few hormones (Column X) and their specific inhibitors (Column Y).

QUESTION ID:82

The following statements were made about major histocompatibility complex (MHC) molecules:

A. Multiple MHC-I molecules can be expressed on a single cell.
B. MHC-I molecules exhibit greater diversity than antibodies.
C. MHC-I haplotypes inherited from the mother and father and expressed on a given cell are codominant.
D. All MHC-I molecules on a given cell express the same endogenous peptide.
E. MHC-I molecules are present on platelets.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:83

Given below are mechanisms that can facilitate major evolutionary transitions, such as the transition from genes to genomes, from unicellular to multicellular organisms, or from individuals to colonies.

A. Conflict mediation mechanisms maintain cooperation within emergent units.
B. Reduced genetic relatedness among cooperating units accelerates these transitions.
C. Division of labour evolves when specialisation increases group-level fitness more than individual fitness losses.
D. Transitions are irreversible once higher-level individuality is achieved.

Which one of the following options is a combination of all correct statements?

QUESTION ID:84

Given below are statements about ion transport proteins in pancreatic duct cells which influence the composition of pancreatic juice.

A. Primary Cl^-/HCO₃- exchanger is located on the luminal side.
B. CFTR is located primarily on the basolateral side.
C. Na⁺–bicarbonate cotransporter is located on the basolateral side.
D. Na⁺/hydrogen exchanger-1 is located on the luminal side.

Which one of the following options has a combination of all correct statements?

QUESTION ID:85

Some features of Transcranial Direct Current Stimulation (tDCS) are stated below:

A. The membrane potential of neurons is modulated by applying a weak electrical current between two electrodes placed on the scalp.
B. Neurons under the anode become depolarized, and neurons under the cathode become hyperpolarized during tDCS.
C. tDCS can disrupt neuronal activity and create a “virtual lesion” via anodal stimulation.
D. Neuronal activity is decreased in regions below the anode and increased in regions below the cathode.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:86

Beyond its primary role in reducing atmospheric nitrogen to ammonia during symbiotic nitrogen fixation, the nitrogenase enzyme complex is also capable of catalyzing other reactions. Listed below are some reactions.

A. Acetylene reduction (C₂H₂ → C₂H₄)
B. H₂ production (2H⁺ → H₂)
C. ATP hydrolysis (ATP → ADP + P_i)
D. Oxidized ferredoxin to Reduced ferredoxin
E. NAD reduction (NAD⁺ + H⁺ → NADH)

Which one of the following options represents the combination of reactions that are NOT catalyzed by the nitrogenase enzyme complex?

QUESTION ID:87

Following statements were made regarding the theory of symbiogenesis in the origin of eukaryotic cells.

A. Mitochondria and chloroplasts have typically their own circular DNA, similar to bacterial DNA.
B. Mitochondria and chloroplasts are surrounded by a single membrane like other organelles.
C. Division of mitochondria and chloroplasts occurs synchronously with the division of nuclear genome.
D. Ribosomes in mitochondria and chloroplasts are similar to those found in prokaryotes.
E. Genetic analysis shows that mitochondrial DNA is closely related to certain proteobacteria.

Which one of the following options has all the correct statements?

QUESTION ID:88

Most vascular plants face two broad challenges that affect their growth, reproduction and evolutionary success. One major challenge (Stress) includes shortages of resources such as light, water, nutrients or other physicochemical limitations. A second major challenge (Disturbance) includes factors such as grazing, diseases, storms, frost, erosion, and fire. When cross tabulated, we get the following table:

QUESTION ID:89

In a plant heterozygous for a reciprocal translocation involving chromosome P (ABCDEFGH) and chromosome Q (123456), meiosis I produces a quadrivalent as shown in the figure, which after meiosis II results in gametes of types labelled X, Y and Z.

Which one of the following combinations correctly represents the segregation pattern of gametes that arise from the quadrivalent configuration as shown in the diagram?

QUESTION ID:90

The table below lists conditions (Column X) and their evolutionary/behavioural outcome (Column Y).

QUESTION ID:91

The taxon cycle is the predicted, progressive ecological and evolutionary changes in the descendants of founding populations. Taking the case of insular biotas, the figure below can be used to conceptualize and predict species types (a, b, c, d, e, f, g, h) in insular biotas based on fundamental capacities to evolve, immigrate and persist.

The table below has species types (Column X) and the possible traits (Column Y) associated with each type.

QUESTION ID:92

The following statements are made about body temperature regulation in humans:

A. Lactic acid and potassium ions are less concentrated in sweat while sweating little than while sweating a lot.
B. When the temperature of the surroundings becomes greater than that of the skin, body loses heat by conduction.
C. When heat is applied directly to the pre-optic area of hypothalamus by inserting a thermode in the brain, the animal begins to sweat profusely.
D. Chemical thermogenesis through thyroid gland stimulation requires weeks of exposure to cold temperature.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:93

The following statements are made regarding the functioning of phytochromes A and B during light signaling in plants.

A. Phytochrome B (PhyB) lacks nuclear localization signal (NLS) and after perceiving light, it takes hours for nuclear import.
B. Phytochrome A (PhyA) contains NLS and its nuclear import occurs rapidly.
C. Pfr form of PhyA depends on FAR-RED ELONGATED HYPOCOTYL 1 (FHY1) and its homolog FHL for nuclear import.
D. Pfr form of PhyB depends on FHY1 and its homolog FHL for nuclear import.

Which one of the following options represents all correct statement(s)?

QUESTION ID:94

Following statements are made regarding sex determination in plants.

A. In Silene latifolia, females are homogametic (XX) and males are heterogametic (XY).
B. Papaya (Carica papaya) shows trioecy, but its sex determination is not associated with sex chromosomes.
C. All dioecious plants with separate sexes possess heteromorphic sex chromosomes.
D. Plant sex chromosomes are ancient, and their Y chromosomes are highly degenerated, much like those in mammals.
E. Unlike animals, dosage compensation is generally weak or absent in plant sex chromosome systems.

Which one of the following combinations contains all INCORRECT statements?

QUESTION ID:95

During development, yfg expression is regulated by proteins E, F and G, which are abundant and have long half-lives. After a “specific stage of development”, the protein E is activated by a single short wave of phosphorylation. This leads to the following events:

• Phosphorylated E activates F.

• Active F activates G.

• Active G promotes yfg expression.

• Active F completely inhibits E, and active G completely inhibits F function.

Which one of the following describes the expression of yfg soon after the “specific stage of development” is reached?

QUESTION ID:96

Circular genomic DNA isolated from actively replicating stages of organisms P and Q were digested with a restriction enzyme that cuts both genomes only once. The electron-micrographs of the digested DNAs are shown below:

The following comments are made on the number of replication origins and directionality of the replication fork(s):

A. In organism P there are two replication origins, and replication is bidirectional.
B. In organism P there is one replication origin, and replication is bidirectional.
C. In organism Q there is one replication origin, and replication is bidirectional.
D. In organism Q there is one replication origin, and replication is unidirectional.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:97

Researchers attempted genetic manipulation of the metabolic pathway shown below for enhanced production of “D”. However, increased expression of gene “N” did not result in increased production of “D” in any transgenic line. Levels of “E” were similar in transgenic as well as untransformed plants.

The following hypotheses were proposed for explaining the observed results.

A. Feedback inhibition of “N” by “D”
B. Epistasis of gene N over gene M
C. Substrate limitation for “N”
D. Feedback inhibition of “M” by “E”

Which one of the following options lists all factors that, either independently or in combination, could explain the above results?

QUESTION ID:98

Given below are the different stages of Arabidopsis embryogenesis (Column X) and their characteristic patterns of cell division (Column Y).

QUESTION ID:99

The following statements are made regarding photosynthesis in a mutant maize (C₄ plant) that lacks functional bundle sheath chloroplasts:

A. Photorespiration would remain low due to PEP carboxylase activity.
B. Calvin cycle would be severely compromised, reducing sugar production.
C. Carbon fixation would shift entirely to mesophyll cells without yield penalty.
D. CO₂ concentration around Rubisco would increase dramatically.

Which one of the following options is a combination of all INCORRECT statements?

QUESTION ID:100

Two Sanger sequencing reactions were carried out using the same DNA template and primer. The sequencing gels are shown below:

Lane A of reaction 2 gel shows the absence of lower bands and accumulation of higher bands (represented by a black thick band). The following reasons are predicted:

A. The template DNA does not contain the base A near its 5′-region.
B. The processivity of the Sequenase enzyme is very high.
C. In the second reaction, the concentration of ddATP is very low.
D. In the second reaction, the concentration of ddTTP is very high.

Which one of the following options represents the correct reason(s)?

QUESTION ID:101

Given below are statements on the citric acid cycle and urea cycle, which have shared metabolic intermediates.

A. Oxaloacetate is converted to aspartate.
B. Fumarate is a citric acid cycle intermediate.
C. Argininosuccinate is cleaved to fumarate and arginine.
D. Aspartate combines with citrulline to produce argininosuccinate in the mitochondrial matrix.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:102

ENZ function prevents premature differentiation of mouse neural stem cells. Kinase inhibitor treatment differentiates these cells prematurely. This is prevented if a specific serine-to-aspartate (S → D) mutation is introduced in ENZ.

Based on this information, which one of the following statements is INCORRECT?

QUESTION ID:103

The following graph represents the enzyme kinetics observed for an enzyme (E) in the presence of two different inhibitors, P and Q, each at two different concentrations (x-axis = 1/v ; 1/(moles/min), y-axis = 1/[S] ; 1/µM).

Based on the graph, what is the substrate concentration (in µM) at which both inhibitors achieve 50% inhibition?

QUESTION ID:104

Recombination between two genes in Neurospora crassa yielded equal numbers of parental ditype (PD) and tetratype (TT), and 12 times as many TT as non-parental ditype (NPD).

What is the distance between the genes in map units (mu)?

QUESTION ID:105

Experiments addressing axis patterning in amphibian embryos are listed in Column X and the observations are listed in Column Y.

QUESTION ID:106

Chromatin immunoprecipitation (ChIP) and RT-PCR were performed to investigate the activation of expression of a particular gene, results of which are shown below. X, Y and Z indicate ChIP with antibodies for specific proteins, and ‘RNA’ shows gene expression at the indicated time points.

Based on the results, choose the option that correctly identifies the X, Y and Z proteins.

QUESTION ID:107

In a monogamous haplodiploid social insect colony, sterile workers assist the queen in producing additional sisters instead of reproducing themselves. According to Hamilton’s rule, altruistic behaviour is favoured when the genetic benefit to relatives (weighted by coefficient of relatedness, r) exceeds the cost (c) to the actor.If a worker helps the queen raise three daughters instead of producing two of her own, then based on Hamilton’s rule, will helping behaviour evolve?

(Assume, genetic unit, which is the number of offsprings weighted by r as a measure of inclusive fitness)

QUESTION ID:108

The following statements propose some of the similarities and differences between classic non-peptide neurotransmitters (CNN) and peptide neurotransmitters (PN):

A. CNN are synthesized at the presynaptic terminal while PN are synthesized in the cell body.
B. PN receptors are confined to the specific synapse at which PN is released like that of CNN.
C. When one neuron (containing both CNN and PN) is stimulated at low frequency, both PN and CNN are released from the presynaptic terminal, but at higher frequencies, only CNN is released.
D. The typical action of CNN has short latency and short duration (milliseconds) while PN action may have long latency and may persist for long duration (seconds).

Which one of the following options represents a combination of all correct statements?

QUESTION ID:109

The following statements are put forth about hormonal changes during normal pregnancy in humans.

A. Pituitary secretion of FSH and LH increases.
B. Aldosterone secretion increases.
C. Glucocorticoid secretion decreases.
D. Thyroxine secretion increases.

Which one of the following options has a combination of all correct statements?

QUESTION ID:110

Signalling pathways that are important for tumorigenesis and cancer include those involved in cell proliferation and cell growth. The following statements were made regarding pathways and molecules involved in cancer:

A. Abnormal activation of the PI3-kinase/Akt pathway is involved in dysregulated growth.
B. Bcl2 overexpression and enhanced apoptosis lead to efficient clearance of damaged cancer cells.
C. Loss of p53 can allow cells with damaged DNA to escape apoptosis and continue to proliferate.
D. Inhibition of the Rho family GTPase RhoC leads to enhanced actin-based cell motility and facilitates metastasis.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:111

Nitrogen cycling is a critical ecosystem process. The table below lists the names of the processes (Column X) and nature of the reactions (Column Y) in the nitrogen cycle.

QUESTION ID:112

Given below are a few statements about meiosis in animal cells. (DROP)

A. Failure of the chiasma formation leads to non-disjunction in meiosis I.
B. Meiotic cohesin Rec8 ensures mono-orientation of sister chromatids in meiosis II.
C. Crossover interference reduces clustering of recombination sites.
D. Residual double-strand breaks arrest meiosis at metaphase.

Which one of the following options has all the correct statements?

QUESTION ID:113

Which one of the following statements about evolution of the vertebrate brain is most accurate?

QUESTION ID:114

In a systematic ecological survey of lepidopterans in a moist deciduous forest, a total of 197 species were recorded with 6814 individuals. The relative abundance data are presented below.

Keeping the above pattern in mind, which one of the statements below is correct?

QUESTION ID:115

Immunoprecipitation (IP) of protein X from cell lysate using anti-X antibody, followed by RT-PCR for mRNA-Y, indicates the presence of protein X–mRNA-Y complex in vivo. To confirm this interaction, recombinant protein X and in vitro transcribed mRNA-Y are incubated, followed by affinity purification of protein X. However, mRNA-Y was not present in the eluates containing X but rather in the unbound fraction.

Given below are a few statements to explain the observations.

A. Protein X and mRNA-Y are expressed at the same level in the cell, so the interaction is robust.
B. Protein X and mRNA-Y physically interact via a bridge protein/co-factor absent in the purified protein X.
C. mRNA-Y binds to the antibody used in the immunoprecipitation.
D. The mRNA-binding domain of the recombinant protein X may have an altered conformation.

Which one of the following is a combination of all correct statements?

QUESTION ID:116

The figure below shows a life cycle graph and the corresponding population projection matrix that is invariant over time for a population with four successive classes (1–4). All contributions to class 1 from other classes is via fecundity.

Given this life cycle, no resource limitation, and initial numbers of individuals
n₁ = 95, n₂ = 5, n₃ = 15, and n₄ = 4 in the four classes, consider the following statements regarding the future population states in a long-term simulation of population growth:

A. The population will grow and attain a stable class distribution.
B. The population will grow but the number of individuals in each class will be proportional to the initial numbers.
C. The population will grow but numbers of individuals in the classes will fluctuate disproportionately over time.
D. The population will grow at a fixed growth rate and all classes will grow at the same rates.

Which one of the following options represents a combination of all correct outcomes?

QUESTION ID:117

The following are four biological processes that occur inside a living cell.

A. Spontaneous cis–trans isomerization of proline in proteins
B. Co-translational protein folding
C. α-helix formation
D. Hydrogen bond formation in free water

Which one of the following options represents the slowest to fastest order of the timescale for these processes?

QUESTION ID:118

In T4 phage, a mutation in the rII locus gives rise to large and round plaques. The wild type plaques are small and ragged. Ten independent mutants (M1 to M10) in the rII locus were isolated. In order to test whether the mutations affected the same protein coding regions, E. coli cells were infected with two mutant phages at a time. The plaques obtained from such infection were either small and ragged (+) or large and round (−). The results obtained from all combinations of infection involving the ten mutants is summarized below:

The following conclusions were drawn from the above observations:

A. The mutants map to two complementation groups.
B. M1 and M10 are mutations in two different genes.
C. Each complementation group is represented by 5 mutants.

Which one of the following options represents a combination of correct statement(s)?

QUESTION ID:119

To test if viral proteins are transported between Golgi stacks in vesicles or are released into the cytosol by one Golgi stack and taken up by another, viral protein transport was examined between Golgi stacks of infected and uninfected cells.

Which one of the following experimental designs would best distinguish these two hypotheses?

QUESTION ID:120

The following statements were made about host–pathogen interactions during influenza virus infection:

A. Entry of the virus is mediated by the interaction of the HA-protein of the virus with sialic acid receptors on the airway epithelium.
B. CTLs are primed in the thymus to kill respiratory epithelial cells that present viral antigens on MHC-I molecules.
C. CTLs are primed in the thymus to kill respiratory epithelial cells that present viral antigens on MHC-II molecules.
D. Viral neuraminidase is required for the release of mature viruses from infected cells.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:121

The following statements are made regarding bioremediation and phytoremediation.

A. Phytovolatilization can reduce soil contamination but may create secondary pollution in the atmosphere.
B. In rhizofiltration, plants are effective only if their roots are exposed to contaminated soil.
C. Phytostabilization reduces contaminant mobility, but the total pollutant load in the soil remains unchanged.
D. Bioventing involves the injection of air or oxygen into soil to stimulate aerobic microbial degradation.
E. During in situ bioaugmentation, the remediation is achieved by physically removing contaminated soil for off-site treatment and replacing it with decontaminated soil.

Which one of the following options represents a combination of all INCORRECT statements?

QUESTION ID:122

Given below are a few statements related to inheritance biology:

A. A crossover is the breakage of two DNA molecules at the same position and their rejoining in two reciprocal recombinant combinations.
B. Crossing over takes place at the four-chromatid stage.
C. As the distance between two genes increases, the recombination frequencies move closer to 50%.
D. Percentage of recombinants between two genes can be used as a quantitative index of the accurate physical distance between them.

Which one of the following options is a combination of all correct statements?

QUESTION ID:123

The table below lists taxonomic groups (Column X) and their morphological features (Column Y).

QUESTION ID:124

The following statements are made with respect to the major classes of heat shock proteins (HSP) in plants.

A. Cytosolic HSP100 is essential while the chloroplast HSP100 / ClpB family protein is not essential for heat stress response.
B. Proteins of HSP90 family are exclusively localized in the nucleus.
C. Members of HSP60 protein family, chaperonins, are abundant even at normal temperatures.
D. The C-terminal domain of small HSPs is homologous to α-crystallins, proteins found in vertebrate eye lens.

Which one of the following options is a combination of all correct statements?

QUESTION ID:125

The following statements describe some of the features of Quartz Crystal Microbalance (QCM) biosensors:

A. A QCM biosensor is built with thin disc-shaped piezoelectric material which is connected to metal electrodes on the opposite faces.
B. If an AC voltage is applied on the quartz crystal, it produces an oscillation at a stable resonant frequency which is not determined by the applied AC voltage.
C. The surface of the quartz crystal is functionalized with a specific receptor that can bind to the target analyte.
D. As the mass on the surface of the crystal is increased, the resonant frequency of crystal increases in a predictable, quantitative way following Sauerbrey equation.

Which one of the following options represents a combination of all correct statements?

QUESTION ID:126

The following statements are made with respect to signal transduction events in phytohormone signalling in plants:

A. Autophosphorylation of a histidine residue in the receiver domain of the response regulator is important for signal transduction through the two-component system.
B. Phosphorylation of a conserved aspartate residue in the transmitter domain of the histidine kinase is important for the two-component system.
C. CYTOKININ RESPONSE 1 (CRE1), a cytokinin receptor, functions as an Arabidopsis histidine-containing phosphotransfer (AHP) factor.
D. In Arabidopsis, pseudo-AHP, called AHP6, acts as an inhibitor of cytokinin signalling.
E. ETR1, an ethylene receptor in Arabidopsis, has histidine kinase activity and a receiver domain.

Which one of the following options is a combination of all correct statements?

QUESTION ID:127

A newly discovered small mammal from Madagascar lays eggs, has a cloaca, and shows electroreception through its snout. Molecular phylogenetics places it basal to all other living mammals. Based on these characters, which one of the following groups can it be assigned to?

QUESTION ID:128

In amphibians and fish, the cells of the organizer ultimately contribute to –
(i) pharyngeal endoderm, (ii) head mesoderm, (iii) dorsal mesoderm, and (iv) dorsal blastopore lip.

The following statements are made about the function of the organizer and its derivatives:

A. The pharyngeal endoderm and pre-chordal plate prevent formation of forebrain and midbrain.
B. The organizer has the ability to dorsalize the ectoderm and induce formation of the neural tube.
C. The dorsal mesoderm inhibits induction of the hindbrain and trunk.
D. The organizer tissue possesses the ability to dorsalize the surrounding mesoderm into somite-forming mesoderm.

Which one of the following options is a combination of all correct statements?

QUESTION ID:129

A 20-bp GC-rich promoter undergoes a conformational transition between the B-form to Z-form of DNA, involving bases 6 to 13. The rest of the bases always remain in the B-form. The B- to Z-DNA transition occurs with a half-life of 2 s, and Z- to B-DNA transition has a half-life of 6 s.

If the cognate transcription factor requires 10 continuous B-DNA base pairs for binding, for how many seconds in a 20 s window can the transcription factor remain bound to the promoter, assuming steady-state conditions?

QUESTION ID:130

Dynamic Light Scattering measurements of a protein encapsulated inside AOT/isooctane reverse micelles suspended in n-heptane at 10 °C and 1 atm show an average hydrodynamic diameter of 17 nm, while the empty micelles have an average diameter of 11 nm. Calculate the approximate hydrodynamic radius of the encapsulated protein, assuming spherical geometry of the protein and the reverse micelle and that the protein only occupies the aqueous core of the micelle.

QUESTION ID:131

A lambda bacteriophage integrated into the genome of E. coli and became lysogenic. Upon UV irradiation, it is expected that the lytic cycle will be induced. Due to mutations that have occurred as a result of UV irradiation, you find that the lambda bacteriophage remains in the lysogenic state and lysis is impaired.

Mutations in the following genes have been proposed to explain this observation.

A. cI gene, protease cleavage site
B. cII gene, DNA binding site
C. RecA gene of E. coli
D. RuvA gene of E. coli

Which one of the following options represents all correct statements?

QUESTION ID:132

The table below gives life history characteristics of an endangered grassland bird in two geographically distinct populations. Assume that the species follows a logistic growth model, calculate the population growth rate (dN/dt) for both populations.

QUESTION ID:133

Given below are names of plants (Column X) and the habitats (Column Y) in which they naturally occur.

QUESTION ID:134

A protein with a binding pocket containing amino acid residues, Asp (pKa = 4.0), and His (pKa = 6.5) interacts with a ligand at pH 7.0 at 25 °C. The binding affinity of the ligand increases 10-fold upon His protonation. Assuming His protonation is the sole contributor to the enhanced binding, calculate the fraction of His residue protonation and the change in the binding free energy corresponding to the enhanced affinity (R = 1.987 cal/mol/K).

QUESTION ID:135

Given below are a few statements regarding Aquaporin-mediated water transport in plants.

A. The activity of aquaporins is regulated by altered pH and Ca²⁺ concentration as well as phosphorylation.
B. Aquaporin activity is also regulated by reactive oxygen species.
C. Aquaporins are restricted only to epidermis and endodermal cells and not present in xylem parenchyma.
D. Aquaporins do not mediate influx of boric acid and salicylic acid into cytosol.

Which one of the following options represents the combination of all correct statements?

QUESTION ID:136

In standard or batch cultures, cells are grown in a fixed volume of medium. As they grow, nutrients are consumed and metabolites accumulate. Eventually, cultures may stop growing because of nutrient depletion and accumulation of toxic products. The following procedures may prolong the life of batch cultures:

A. Gradual addition of fresh medium and increasing volume of the culture
B. Replacing a constant fraction with an equal volume of fresh medium
C. Occasional removal of used medium and reducing growth factors in the medium
D. Intermittently adding serum and growth factors to the medium

Which one of the following combinations will ensure healthy growth of cells in culture?

QUESTION ID:137

In an in vitro translation reaction, the 43S pre-initiation complex (PIC) was incubated with the in vitro transcribed and capped mRNA for Gene X, followed by addition of the 60S subunit. As a control, mRNA for Gene Y isolated from cells was incubated in the same reaction. The mRNA for Gene Y was bound to the 80S ribosomes and polyribosomes, while mRNA of Gene X remained unbound.

In a parallel experiment, mRNAs for both Gene X and Gene Y were found to be associated in vivo with 80S and polyribosomes.

The following statements were made to explain the above observation.

A. The in vitro system was globally defective for 80S assembly.
B. Gene X mRNA has a sequence or structural feature that specifically prevents 80S assembly in vitro.
C. Gene X mRNA lacks a start codon.
D. Gene X mRNA requires other cellular factors which are absent in the in vitro mix to permit initiation.
E. The in vitro assay preferentially degrades Gene X mRNA.

Which one of the following options represents all correct statements?

QUESTION ID:138

Given below are different types of mapping populations in plants (Column X) and their characteristic features (Column Y).

QUESTION ID:139

In eukaryotes, many cells can assemble a spindle in the absence of centrosomes as in the case of plant cells during mitosis, and animal cells during meiosis in females. In this context, centrosome-free mitotic extracts from frog oocytes, when supplied with beads covered with DNA, are sufficient to assemble the mitotic spindle. Listed below are a few proteins that could be involved in spindle assembly in such a setting:

A. Ran GTPase
B. Ran-GEF
C. TPX2
D. Myosin V

Which one of the following options has all proteins that are directly involved in controlling spindle assembly without centrosomes?

QUESTION ID:140

Following statements are made regarding abscisic acid (ABA) signalling during water stress in plants.

A. ABA causes membrane depolarization by decreasing cytosolic calcium levels.
B. ABA causes alkalinisation of the cytosol which stimulates opening of K⁺ efflux channels.
C. ABA inhibits the activity of the plasma membrane H⁺-ATPase which results in membrane depolarization.
D. During stomatal closure, ABA induces reorganization of tubulin cytoskeleton mediated by Rho GTPases.
E. ABA induced membrane depolarization occur by release of calcium from endoplasmic reticulum and vacuoles.

Which one of the following options is a combination of all correct statements?

QUESTION ID:141

Column X lists different types of ion channels and column Y defines the nature/property of these channels.

QUESTION ID:142

A eukaryotic protein ‘X’ activates a target gene by increasing its transcription when an inducer is added. The results of the experiments are shown in the table below.

QUESTION ID:143

The physiological regulation of plasma osmolality by osmotically active neurons (osmoreceptors) in the organum vasculosum of lamina terminalis (OVLT) of hypothalamus is described in the following statements:

A. In hyperosmolar state, the non-selective cationic channels in the osmoreceptor membrane become active causing hyperpolarization of receptor cells.
B. In hyperosmolar state, shrinkage of osmoreceptor cells occurs.
C. Activated osmoreceptors send action potentials to the supraoptic nucleus (SON) and paraventricular nucleus (PVN) to release arginine vasopressin (AVP).
D. In hypoosmolar state, the stretching of osmoreceptor membrane causes inactivation of transient receptor vanilloid protein 4 (TRVP4) resulting in the activation of osmoreceptors.

Which one of the following options represents a combination of all correct statements?

QUESTION ID:144

The following experimental observations are made when a small ligand binds with nanomolar affinity in a deep hydrophobic pocket of the partner protein.

A. The ligand forms a hydrogen bond with a backbone carbonyl oxygen upon binding.
B. Several nonpolar groups in proteins form a hydrophobic network due to the conformational change, leading to the displacement of buried water molecules to the surface.
C. A negatively charged side chain of an amino acid located near the binding site is desolvated.
D. The desolvated side chain of an amino acid located near the binding site does not form a salt bridge with the ligand.

Which one of the following options represents the combination of all correct statement(s) that explain(s) net stabilisation of the ligand:protein complex?

QUESTION ID:145

The following statements are made regarding colchicine treatment in plants for inducing polyploidy.

A. In colchicine-treated cells, sister chromatids cannot separate during anaphase, leading to chromosome doubling when the nucleus reforms.
B. Colchicine stimulates endoreduplication in the treated cells, bypassing cytokinesis to yield polyploid cells in a process called “C-mitosis”.
C. In sterile interspecific hybrids, colchicine treatment may restore fertility by converting them into amphipolyploids.
D. Colchicine treatment during meiosis has no effect, as it only acts on mitotic cells.
E. Colchicine binds to tubulin and prevents spindle fibre formation during mitosis.

Which one of the following options represents a combination of all correct statements?