Previous Year Questions

Performance Meter

0%

TLS Online TPP Program

QUESTION ID:1

Two circles of radii 9.0 units and 4.0 units touch each other externally as in the figure. Then the length (in units) of their common tangent AB is

QUESTION ID:2

The production of goods in a factory over 9 months is shown in the graph

The average growth (in tons per month) over the period under consideration

QUESTION ID:3

Starting at the same time policewomen A and B chase thief T. They all run in the same direction at constant speeds. A runs twice as fast and B thrice as fast as
T. If A and B catch up with T at the same time, B must have started

QUESTION ID:4

Consider a string of letters and a mirror placed below it as shown.
LPSARB
Which of the following is the correct reflection of the string?

QUESTION ID:5

Four students Alpana, Behram, Ramesh and Doug joined a college in 1991 , 1992, 1993 and 1994 but not necessarily in that order. Each student joined one of the four departments, viz. Physics, Chemistry, Mathematics and Biology. No two students joined the same department. One of those who joined the collegebefore 1993 joined Chemistry. No one joined the college after Ramesh. Dougjoined Physics. Alpana joined one year after Doug but didn't join Chemistry. Then Behram joined the college in the year

QUESTION ID:6

The following 15 observations are heights (in inches) of 15 persons
65, 61, 63,65,61,61,60, 60,65,85,65,86, 61,65,62
Which of the following is true?

QUESTION ID:7

A test consists of 20 questions. A correct answer fetches 4 marks and a wrong answer is penalised by deducting 1 mark. Un-attempted questions fetch nothing. The number of triplets of (#correct, #incorrect, #unattempted) which give a score of 40, is

QUESTION ID:8

A large rectangular paper having sides in the ratio of 3:8 is cut in half across thelonger side. The process is repeated several times. At which stages of the repeated cuttings will the ratio of the sides be 3:8?

QUESTION ID:9

Let 2a3b 5c = 1200 where a, b, c are integers. Then a+ 2b + 3c is

QUESTION ID:10

Four villages form the vertices of a rectangle of dimensions 8.0 km x 6.0 km. Roads are to be laid connecting the villages such that the distance by road between each pair of villages is the same. The shortest such road distance (in km) between any pair of villages will be

QUESTION ID:11

Which one of the following represents the most precise measurement of a length?

QUESTION ID:12

Which of the following equations represents the graph shown?

QUESTION ID:13

Angela travels from town A to town T, 10 km away. When she's halfway, Betty starts from town B for T, 15 km away. When Betty is half way, Charlie starts from town C for T, 30 km away. When he's half way, Dave starts from town D for T, 40km away. If their speeds are uniform and in the ratio 1 :3:12:16, respectively, the last one to reach Twill be

QUESTION ID:14

One letter is picked at random from each of the words LUNAR and LANDER. The chance that the letters picked from both words belong to the word PRAGYAN is

QUESTION ID:15

Two semicircles are drawn in a square with sides as diameters as shown. If the side of the square is 2 units, how much is the shaded area (in sq. units)?

QUESTION ID:16

Incomes (in lakhs) of two persons A and B, over the years 2006-2010 are shown in the graph

Which of the following statements is true?

QUESTION ID:17

100 ml of alcohol from container A containing 1 l of alcohol is transferred to another container B containing 1 l of water and mixed well. From this, 100 ml is transferred back to container A. The amount of alcohol in container B would be

QUESTION ID:18

In the following finite sequence of integers, how many terms are divisible by their immediate next terms?
8,3,4,9,3,5,9,5,9,9,9,4,5,6,3,3,5,7,2,3,9,9

QUESTION ID:19

Among A, B, C and D, one is a doctor, one is a teacher, one is an engineer,and the other is a lawyer. The teacher is older to B but younger than D. B is older to the doctor and younger than C. Which among the following is a conclusive inference?

QUESTION ID:20

Suppose some Basketball players play Cricket, all Tennis players play Cricket, and no Tennis player plays Basketball. Which one of the following Venn diagrams correctly represents the relationship among Basketball, Cricket and Tennis players' groups?

QUESTION ID:21

An enzyme "X" converts a L-amino acid to a racemic mixture of D- and L- forms. Which one of the following coenzymes is utilized by enzyme X for this conversion?

QUESTION ID:22

Which one of the following statements about the molecular clock hypothesis as proposed by Zuckerkandl and Pauling 1962 is CORRECT?

QUESTION ID:23

Which one of the following statements about clamp loader is NOT correct?

QUESTION ID:24

As per Aichi Target 11 of the Convention on Biological Diversity, what percentage of geographical area was proposed to be protected for biodiversity conservation by the year 2020?

QUESTION ID:25

As per the ENVIS database, approximately how much of India's landmass is designated under various categories of protected areas for biodiversity conservation, as of January 2023?

QUESTION ID:26

Which one of the following statements about biological membranes is INCORRECT?

QUESTION ID:27

Which one of the following hormones elicits its cellular response by producing cAMP as a second messenger?

QUESTION ID:28

Which microscope is typically used to detect a single fluorescent molecule?

QUESTION ID:29

Which one of the following strategies will generate the most precise mutation at the predetermined location of a plant genome?

QUESTION ID:30

The tri-snRNP particle is composed of:

QUESTION ID:31

According to the latest IUCN Red List (2022), which one of the following groups has the highest percentage of assessed species that are threatened with extinction?

QUESTION ID:32

Which one of the following statements about ATP generating mitochondria is TRUE?

QUESTION ID:33

Which one of the following statements about determination of ABO blood types is INCORRECT?

QUESTION ID:34

The hematocrit of human blood is highest when collected from:

QUESTION ID:35

Which one of the following pollutants does NOT concentrate in organisms at higher trophic levels due to biomagnification?

QUESTION ID:36

Which one of the following is NOT an example of learning?

QUESTION ID:37

DNA from a strain of bacteria with genotype a+ b+ c+ d+ e+ was isolated and used to transform a strain of bacteria that was a- b- c- d- e-. The transformants were tested for the presence of donated genes. The following genes were co-transformed: a+ and c+ b+ and d+ e+ and d+ c+ and b+
Which one of the following options given correct order of genes on the bacterial chromosome?

QUESTION ID:38

Which one of the following is the major antibody in the early stages of a primary immune response?

QUESTION ID:39

Which one of the following statements is a characteristic property of B cell epitopes on a protein?

QUESTION ID:40

In which one of the following organelles does glycine decarboxylase complex and serine hydroxymethyltransferase convert two molecules of glycine into one molecule of serine during photo respiration

QUESTION ID:41

Which one of the following statements about Anthrax is correct?

QUESTION ID:42

Using an analytical ultracentrifugation sedimentation velocity run, a researcher has calculated theS value (Svedberg units) of a part of the freshly purified 12 kDa enzyme to be ~ 1.83,corresponding to its monomeric state. However, during an identical run of the remaining protein after 2 days, the researcher finds that the S value increased to~ 2.57. What would be the correct conclusion about the enzyme in question?

QUESTION ID:43

Which one of the following exhibits ATPase and helicase activities for promoter opening and clearance?

QUESTION ID:44

The mobile signal, florigen, that controls the flowering status of the plants in encoded by which one of the following?

QUESTION ID:45

Many signal transduction pathways work as molecular switches. On receiving a signal, they switch from an inactive form to an active form. They return to the inactive form when another signal switches them off. Which of the following processes does NOT directly involve a molecular switch?

QUESTION ID:46

While developing genetic maps, Alfred Sturtevant proposed that genetic distances are additive. From test crosses involving two genes, if the genetic distance between genes A and B was observed to be 15 cM and between B and C was 10 cM, then the percentage of recombinants observed between A and C would be 25, given that the arrangement is A-B-C. This will be observed only when there is:

QUESTION ID:47

Which one of the following statements about human transposons is INCORRECT?

QUESTION ID:48

Which of the following is a co-translational amino acid modification, rather than a posttranslational modification?

QUESTION ID:49

A researcher measures the height of 50 teak trees in wet and dry habitats. Which one of the following options is an appropriate statistical test to determine if heights significantly differ in wet and dry habitats?

QUESTION ID:50

Absence of dormant buds and absence of annual growth rings in a fossilized trunk specimen of a coal swamp plant indicates:

QUESTION ID:51

Juvenile hormone is secreted by which one of the following glands?

QUESTION ID:52

Which one of the following amino acids is present in vasopressin at position 3?

QUESTION ID:53

A researcher, while studying vernalization in plants, has made the following statements. Choose the INCORRECT one.

QUESTION ID:54

The amount of energy required to break a single covalent bond is:

QUESTION ID:55

Which one of the following statements about different cellular junctions is INCORRECT?

QUESTION ID:56

Which one of the following statements about the guardee protein, that plays an important role during plant-pathogen interactions is correct?

QUESTION ID:57

The meeting of sperm and eggs in a dilute concentration is one of the challenges of external fertilization. Which one of the following proteins helps in overcoming the challenge?

QUESTION ID:58

Which one of the following statements is correct for early embryonic development in terms of differentiation?

QUESTION ID:59

An herbivore eats food that provides 1,000 kJ of energy of which, 500 kJ is lost in faeces, 350 kJ is used in cellular respiration, and 150 kJ is used for growth. The percent production efficiency of the herbivore is:

QUESTION ID:60

Which one of the following options represents parts of a tRNA that are involved in amino acid charging and interaction with the mRNA, respectively?

QUESTION ID:61

To evaluate insulin-dependent diabetes, clinicians prefer evaluating mono-glycated hemoglobin, referred to as HbA 1 c, which occurs due to a nonenzymatic reaction between glucose and a few amino acids in hemoglobin. Which of the following amino acids arelikely to be involved in the modification of hemoglobin?

QUESTION ID:62

What is the typical maximum sustainable yield for a fish population, given that its carrying capacity (K) is 20,000 and intrinsic growth rate (r) is 0.15?

QUESTION ID:63

Monozygotic and dizygotic twins are used to study the onset of mental illness. The influence of genetic factors on these diseases can be done by calculating the:

QUESTION ID:64

The base composition of the genome of a newly identified virus is given below: Adenine: 25%; Cytosine: 35%; Guanine: 30%; Thymidine: 10% Based on this information, the genome of this virus is:

QUESTION ID:65

Phelloderm is derived from:

QUESTION ID:66

Using patch-clamp technique, one can find the ligands that could influence specific ion channel. How many molecules of acetylcholine are required to open an acetylcholine receptor ion channel in such an experiment?

QUESTION ID:67

The volume of the pleural fluid in a healthy human is:

QUESTION ID:68

Mutants and transgenic models have played a pivotal role in understanding development. Which one of the following statements is true?

QUESTION ID:69

Mammalian cells that have just crossed the Restriction Point of the cell cycle are likely to have:

QUESTION ID:70

Which one of the following statements regarding the production of various reactive oxygen species during oxidative burst is INCORRECT?

QUESTION ID:71

A researcher captured 45 fish from a lake on day 1, tagged and released them back. On day 2 the researcher caught 50 fish out from the same lake, of which 15 were already tagged. Estimate the population size of fish in the lake with this information and pick the correct option

QUESTION ID:72

Plotless sampling techniques have been applied by plant ecologists when rapid estimates of the density of plants in a large region are needed. The image below depicts one of the techniques. P is the sampling point, Xi and z; are distances measured from points P and I, and points I and Q , respectively. The canopy with the crossbar indicates the location of a tree

Which one of the following options correctly identifies the technique?

QUESTION ID:73

During metaphase to anaphase transition, complete removal of cohesin allows sister chromatids to separate and move to opposite poles of the spindle. Given below are a few proteins/protein complexes involved in mitotic progression
A. Cdc20
B. APC/C
C. Separase
D. CyclinA
Which one of the following options represents the protein(s)/protein complexes involved in cohesin removal at the onset of anaphase during mitosis?

QUESTION ID:74

Given below are two figures (X and Y) representing molecular markers and their profiles in parental lines (P1 and P2) and F1 progeny
The following statements describe the nature or probable identity of markers in the above figure:
A. Panel X represents a codominant marker.
B. Panel X represents a dominant marker while Panel Y represents a codominant marker
C. Panel X could be SSR marker while Panel Y could be a RAPD marker
D. Panel Y represents a dominant marker
Which one of the following options represents a combination of all correct statements?

QUESTION ID:75

Various types of processed eukaryatic endogenous mRNA are mentioned below:
A. Unspliced and polyadenylated mRNA.
B. Polyadenylated and capped, unspliced mRNA.
C. Polyadenylated, spliced, capped mRNA
D. Spliced, uncapped, polyadenylated mRNA
Choose the option that identifies all the mRNA species that can be exported to the cytosol

QUESTION ID:76

Following statements are given regarding cell toxicity due to heavy metals in plants:
A. The uptake of heavy metals does not lead to accumulation of ROS
B. They usually mimic essential metals (e.g. Ca2+, Mg2+ etc.) and take their place in essential reactions
C. Ion channels that transport essential metals do not participate in transport of heavy metals
D. Heavy metals can directly interact with oxygen to form ROS
Which one of the following options represents all correct statements?

QUESTION ID:77

Christiane NOsslein-Volhard and Eric Wieschaus carried out an extensive mutation screen to identify all genes involved in segmentation of Drosophila. The graph shows results of analyzing mutations on chromosome 2. 

Based on the above figure, which one of the following options is a correct statement?

QUESTION ID:78

The insulin receptor is activated on binding insulin molecules. This leads to the activation of the downstream Pl3K pathway that triggers AKT to phosphorylate and inactivate a FOXO transcription factor. The lipid phosphatase PTEN antagonizes the Pl3K pathway. A reduction of function mutation in the insulin receptor dramatically increases life span of an organism
The following statements were made regarding the mutations and their outcomes
A. A gain of function mutation in AKT makes the organism long-lived
B. A FOXO deletion mutation suppresses the long life span of the organism with a reduction of function mutation in the insulin receptor.
C. A PTEN deletion mutation suppresses the long life span of the organism with a reduction of function mutation in the insulin receptor.
D. A loss of function mutation in the FOXO ortholog makes the worms long-lived.
Which one of the following options represents the correct combination of the statements?

QUESTION ID:79

Nephrons are structural and functional units of the kidneys. Certain statements are made below about structure and function of a nephron
A. P cells of the collecting duct are involved in Na• reabsorption and vasopressin-stimulated water reabsorption.
B. P cells of the collecting duct are concerned with acid secretion and HCO3· transport
C. I cells of the collecting duct are concerned with acid secretion and HCO3· transport
D. The total length of the nephrons including collecting ducts ranges from 45 to 65 mm
Which one of the following options has all correct statements?

QUESTION ID:80

G-protein-coupled receptors (GPCRs) form the largest family of cell surface receptors. The GPCRs activate G proteins. G proteins are usually composed of three subunits: a, Î² and y. The typical features of these subunits and the receptor activation are:
A. Ga is membrane-bound, and in an unstimulated state it binds to GDP.
B. Ga is non-membrane bound, and in an unstimulated state it binds to GDP.
C. After binding to the ligand, GPCR acts like a guanine nucleotide exchange factor (GEF) and helps in Ga activation.
D. RGS proteins act as a-subunit-specific GTPase-activating proteins (GAPs)
Which one of the following combinations marks all correct statements?

QUESTION ID:81

Following statements were made about supercoiling of DNA:
A. DNA supercoiling acts as a regulator of gene expression, but not for genome organization.
B. Circular DNAs found in mitochondria, viruses and bacteria are invariably negatively supercoiled
C. A moving RNA polymerase generates positive superhelical tension in the DNA in front of it, and negative helical tension behind it
D. Human topoisomerase I cuts both the strands of supercoiled DNA to undergo a controlled rotation to relax the supercoiled DNA.
E. Human topoisomerase II makes a transient break in single strands of a DNA duplex which rotates around a phosphodiester bond in the intact strand to relax the supercoiled DNA
Which one of the following options is a combination of all correct statements?

QUESTION ID:82

Given below is a schematic representation of the T-DNA region of a binary vector used for genetic transformation of plants. The figure shows the presence of restriction sites for EcoRV and probes (labelled 1 - 4) for Southern hybridization to analyse copy number of T-DNA in the transgenic plants

Given below are probes or combination of probes that were used by researchers for Southern blotting following digestion of genomic DNA with EcoRV.

A. Probe 3 and Probe 4

B. Probe 1 and Probe 3

C. Probe 1 only

D. Probe 2 only

E. Probe 1 and Probe 4

Which one of the following options represents the correct combinations of probes that would identify single copy integration events from BOTH flanks of T-DNA?

QUESTION ID:83

The following table lists selected concepts (Column X) in behavioral biology and their descriptions (Column Y):

Here's the information from the image presented in a table format:


Column X


Column Y

A

 Allee effect

i

Male-male interactions increase plasma testosterone and thus sustain subsequent aggressive behavior.

B

 Bateman's hypothesis

ii

Parasites and pathogens play an important role in sexual selection when secondary sexual traits are costly and condition-dependent.

C

 Challenge hypothesis

iii

A situation in which the fitness of individuals increases with increased population density.

D

 Hamilton-Zuk hypothesis

iv

Female reproductive success is most strongly limited by the number and success of eggs that she can produce, while male reproductive success is limited by the number of matings he has.

Which one of the following options represents the correct match between Column X and Column Y?

QUESTION ID:84

This is a hypothetical example. Sequencing of the genome of an organism led to the identification of several ORFs. One of them was found to code for a protein that showed sequence similarity to proteins known to have a role in early development. The protein was named as Brainy. The results of RNA in situ hybridization in egg and 4-celled embryo is schematically depicted below: 

Further, based on fate map, it was proposed that the B4 blastomere gave rise to the notochord. Different experiments were carried out which led to the hypothesis that notochord developed autonomously by acquiring and retaining Brainy.

The following statements represent experiments that could support the above hypothesis and is also correctly matched with the outcome:

A. Microinjection of brainy mRNA in other blastomeres would lead to ectopic development of notochord.

B. If the 4 blastomeres were dissociated and allowed to develop individually, the B4 blastomere would cease to develop

C. Treatin~ the 4-celled embryo with lithium chloride would lead to the ventralization of the  embryo

D. Microinjection of morpholinos against brainy mRNA in B3 would convert the fate of B3 to that of B4

Which one of the following options represents statements that support the hypothesis?

QUESTION ID:85

The following table shows common millets (Column X) and their scientific names (Column Y):  


Column X


Column Y

A

 Ragi (Finger millet)

i

 Eleusine coracana

B

Jowar (Great millet)

ii

 Paspalum scrobiculatum

C

 Kodo millet

iii

 Pennisetum typhoides/glaucum

D

 Bajra (Pearl millet)

iv

 Sorghum bicolor

Which one of the following options represents the correct match between Column X and Column Y?

QUESTION ID:86

Given below are two figures (X and Y) representing the segregation of molecular markers in 12 individuals of a mapping population (1 to 12). P1 and P2 represent the parents, and F1 the hybrid
The following statements are made based on the above figures: 
A. Figure X represents profile of a codominant marker in an F2 population.
B. Figure Y represents profile of a codominant marker in a doubled haploid population.
C. Figure Y represents profile of a dominant marker in an F2 population
D. Figure X represents profile of a dominant marker in a doubled haploid population.
Which one of the following options represents a combination of all correct statements? 

QUESTION ID:87

The following statements were made with reference to the strategies used to identify the organizer molecules like Noggin:
A. A cDNA library was prepared from a lithium chloride treated amphibian gastrula. The organizer molecule was identified from a clone whose mRNA could rescue the phenotype of a UV-irradiated 1-cell embryo and allow normal development.
B. Clones of cDNA whose mRNA was present in dorsalized but not in ventralized embryo were tested by injecting them into ventral blastomeres and seeing whether they induced a secondary axes
C. The molecule, an inhibitor of both Activin and BMPs, caused ectoderm to become a neural tissue
Which one of the options is/are correct?

QUESTION ID:88

Which one of the following graphs typically represents the change in C:N ratio over time in decomposing leaf litter in temperate forests? 

QUESTION ID:89

The table below summarizes various Hormones (in Column X) and induced cell responses mediated by them via Cyclic AMP (in Column Y).


Hormone (Column X)


Major Response (Column Y)

(A)

 Epinephrine

(i)

Increasing heart contraction

(B)

 Vasopressin

(ii)

 Progesterone secretion

(C)

Glucagon

(iii)

 Water resorption

(D)

 Luteinizing hormone

(iv)

 Glycogen breakdown

(E)

 Parathyroid hormone

(v)

 Bone resorption

Match all correct combinations from the options given below: 

QUESTION ID:90

Which one of the following intermediate enzymatic reactions would be most effective in facilitating ligation of a blunt-ended insert fragment with a vector digested with EcoRI restriction enzyme (G I AA TTC)?

QUESTION ID:91

This is a hypothetical example. The pedigree for a monogenic trait is given below. The shaded individuals show spotted skin color while the rest have uniform skin color. The individuals (1 to 9) in the pedigree were analyzed for a DNA marker (both fragments) that shows complete linkage with the skin color trait

The following statements were made regarding the above observations:

A. Spotted skin color is a dominant phenotype.

B. Spotted skin color shows variable expressivity.

C. The DNA marker associated with the skin color trait is co-dominant.

D. The probability that the individual 5 will pass on the allele responsible for the spotted skin color to the next generation is 0.25

Which one the following options represents the combination of all correct statements?

QUESTION ID:92

Competition between two species (A and B) can be represented as vector field graphs. Competition in its classic form can have four qualitative outcomes based on the placement of linear isoclines in four qualitatively distinct patterns as shown in the graphs below. Here, when two isoclines cross each other at the equilibrium point, it is called an attractor. Select the correct graph where both species are expected to coexist for an extended period of time

QUESTION ID:93

Apart from the interaction of antigenic peptide with the TCR-CD3 complex (signal 1 ), T-cell activation requires another signal termed as "Co-stimulatory signal" (signal 2). Given below are a few statements regarding the co-stimulatory signal.
A. All three professional antigen-presenting cells (dendritic cells, macrophages, and B cells) possess the same capacity in respect to delivering the co-stimulatory signal.
B. Co-stimulatory signals are not antigen-specific.
C. The principal co-stimulatory molecules expressed on antigen presenting cells are B7 -1 and B7-2.
D. Unlike B7, CD28, the ligand for B7 which is expressed on T cells, is not a member of immunoglobulin superfamily.
Which of the above statement(s) is/are NOT true?

QUESTION ID:94

Some of the statements given below are related to species that show r- or k-selection strategies:
A. Maximum rate of increase of a population
B. Density of individuals supported by the environment at equilibrium
C. Life history evolution
D. Liebig's law of the minimum
E. Precociality and altriciality
Choose the option that contains all the correct statements related to r- and k-selection strategies

QUESTION ID:95

Given below are statements regarding the specialized embryonic structure of the grass family:

A. The scutellum forms the interface between the embryo and the starchy endosperm tissue.

B. Coleorhiza protects and covers the first leaf while buried in the soil.

C. Coleoptile forms a protective sheath around the radicle.

D. In some species such as maize, the upper hypocotyl has been modified to form a mesocotyl.

Which one of the following options represents a combination of all correct statements?

QUESTION ID:96

Which one of the sequences given below is a portion of a potential microRNA precursor?

QUESTION ID:97

Which one of the following options correctly depicts the stereo-conformation of the dipeptide derivative of Aspartic acid and Phenylalanine? 

QUESTION ID:98

Following statements are made about DNA base excision repair (BER):
A. BER process begins with a DNA glycosylase, which extrudes a base in a damaged base pair, then clips out the damaged base.
B. In bacteria, DNA polymerase Ill fills in the missing nucleotide in BER.
C. Eukaryotic apurinic/apyrimidinic (AP) endonuclease (APE1) performs proofreading activities.
D. APE1 possesses 5 → 3 exonuclease activity
Which one of the following options shows combination of all correct statements?

QUESTION ID:99

Changes in cancer-critical genes/proteins in different human tumours were analyzed. Gene amplification or deregulation leads to increased expression (X) while mutations, deletions, or recombination leads to inactivation (Y)

Column X


Column Y

A

E-cadherin, Smad4, Ras, Myc

i

PTEN, APC, AKT, Her2

B

AKT, Ras, Myc, Her2

ii

PTEN, E-cadherin, APC, Smad4

C

AKT, Ras, Myc, Smad4

iii

PTEN, E-cadherin, APC, Her2

D

E-cadherin, AKT, Ras, Myc

iv

Her2, PTEN, APC, Smad4

Which combination of X and Y is most likely to be found in the tumours?

QUESTION ID:100

Given below is a table listing selected extant molluscs (Column X) and a range of eye complexities (Column Y) found in them


Column X

Column Y

A. Limpet

i. Complex camera lens-type eye

B. Marine snail

ii. Eyecup

C. Nautilus

iii. Eye with primitive lens

D. Squid

iv. Patch of pigmented cells

v. Simple pinhole eye

Which one of the following options represents the correct match between Column X and Column Y? 

QUESTION ID:101

The following statements are made regarding diverse strategies adopted by fungal pathogens:
A. HC toxin inhibits histone deacetylase of the host plant.
B. Oxalic acid produced by fungal pathogens suppresses early plant defense responses.
C. Oxalic acid produced by fungal pathogens induces callose deposition in the infected tissues.
D. HC toxin targets plasma membrane-localized H+-ATPase in the host plant.
Which one of the following options represents all correct statements?

QUESTION ID:102

Lung surfactant is composed of phospholipids and proteins and plays an important role in lowering the surface tension of alveoli when they are small in size. The following statements suggest the structure and functions of proteins in lung surfactant:
A. Surfactant protein B (SP-B) and surfactant protein C (SP-C) are the key protein members of monomolecular film of surfactant.
B. Surfactant protein A (SP-A) is a large glycoprotein and has a collagen like domain within its structure.
C. SP-A does not play any role in the feedback uptake of surfactant by the type II alveolar epithelial cells.
D. The formation of phospholipid film lining the alveoli is inhibited by the proteins in surfactant
Which one of the following options represents the combination of correct statements?

QUESTION ID:103

A knock-in cassette was constructed in order to introduce the j3-casein gene in an animal cell. The viable clones were selected using a double-marker system, with G418 (neomycin analog) and ganciclovir. Identify the correctly designed cassette from the options given below. (SoH - sequence of homology; Gol - gene of interest; neo' - neomycin resistant; tk - thymidine kinase)

QUESTION ID:104

Consider a disease caused by a recessive allele. In a study population, one out of every 500 individuals (0.20%) has the disease. Based on the Hardy-Weinberg equation, what is the percentage of individuals who are carriers of the recessive allele for the disease?

QUESTION ID:105

A cross was carried out between two strains of Neurospora carrying alleles 'A' and 'a', respectively. The cross led to the following octad patterns. The numbers in the last row indicate the number of octads observed with the given pattern
In what percentage of meiocytes did segregation occur at Anaphase II? 

QUESTION ID:106

Two teams of researchers (I and II) extracted chromatin from nuclei and examined them with an electron microscope. The Team I found that isolated chromatin resembles beads on a string. In contrast, Team II found that isolated chromatin appears as a condensed fiber of 30 nm in diameter
Given below are a few reasons for these different outcomes
A. Team I isolated the chromatin with low-ionic-strength buffer, and Team II isolated chromatin with an ionic strength of ~0.15M KCI (physiological ionic strength).
B. Team I isolated the chromatin with ~0.15M KCI and Team II did it with a low-ionic-strength buffer.
C. For Team II, the nuclear isolation method was not appropriate, and they had contamination from the cytoplasmic pool, leading to the appearance of the chromatin as a condensed
fiber.
D. Team I chromatin got sheared during isolation, thus giving the appearance of beads on a string.
Among the statements given above, which statemenUs most appropriately defines the divergent outcomes of Team I and Team II?

QUESTION ID:107

The critical micellar concentration (CMC) of a detergent is 5 mM. Choose the option that uses the minimum amount of detergent that can be used for cell lysis and is least likely to denature soluble proteins?

QUESTION ID:108

Following table shows cultivated crops (Column X) and the continents where their centers of origin (Column Y) are situated:

Column X

Column Y

A. Coffee

i. South America

B. Pineapple

ii. Africa

C. Banana

iii. Asia

D. Rubber

Which one of the following options represents the correct match between column X and column Y?

QUESTION ID:109

Endothelial cells which form the innermost layer of blood vessels secrete many vasoactive substances. The formation and functions of some of these vasoactive substances are proposed in the following statements:
A. Prostacyclin produced by the endothelial cells promotes vasoconstriction.
B. Inhibitors of the cyclooxygenase increase the production of prostacyclin.
C. When endothelial cells are stimulated by acetylcholine or serotonin, nitric oxide (NO) is released that causes relaxation of vascular smooth muscle.
D. NO is short-lived and inactivated by haemoglobin.
Which one of the following options represents the combination of correct statements?

QUESTION ID:110

Some of the sequence of events involved in phototransduction in rod cells upon illumination are given below:
A. Hyperpolarization
B. Activation of phosphodiesterase
C. Decreased release of synaptic transmitter
D. Activation of transducin
E. Decreased intracellular cGMP
F. Conformational change in rhodopsin
Choose the correct sequence of events in visual transduction during light perception

QUESTION ID:111

The loci for three mutations on X-chromosome, yellow body colour (y), cross-vein less (cv), and forked bristles (f) are shown below in the map

The interference between these genes is zero. A male fly with yellow body, cross-vein less and forked bristles was crossed with virgin female flies homozygous for the wild type phenotype. The F1 flies were sib-mated and a total of 1000 F2 progeny flies were obtained.

Which one of the following options represents a correct conclusion from the analysis of F2 progeny?

QUESTION ID:112

If the length of a single continuous a-helical polypeptide is 108 A, which one of the following statements is true?

QUESTION ID:113

Following statements are made regarding the plant hormones, Gibberellins.
A. Gibberellins are ubiquitous in plants and are also present is several fungi.
B. GA1 is the most abundant gibberellin produced in the fungus Fusarium fujikuroi.
C. The exogenous application of gibberellin, GA3 stimulates dramatic stem elongation in the dwarf maize mutant but has little effect on the tall, wild-type plant.
D. The application of exogenous gibberellins causes upregulation of the GA20 oxidase and  GA3 oxidase genes.
Which one of the following options represents the combination of all correct statements?

QUESTION ID:114

Given below are inhibitors of electron transport (Column X) and their target enzymes (Column Y)



Column X


Column Y


Inhibitors of electron transport


Respiratory chain complex enzymes

A

Dicyclohexylcarbodiimide and Oligomycin

i

NADH coenzyme Q reductase

B

Rotenone and Demerol

ii

ATP Synthase

C

Thenoyltrifluoroacetone and Carboxin

iii

Succinate coenzyme Q reductase

D

Cyanide and Azide

iv

Cytochrome c oxidase

Which one of the following options represents all correct matches between Column X and Column Y

QUESTION ID:115

Western Ghats of India is considered as one of the global biodiversity hotspots because of some of the following characteristics:
A. High species richness
B. High endemism
C. Habitat loss
D. Large altitudinal range
Which one of the following options represents the correct combination of characteristics that qualifies the Western Ghats as a biodiversity hotspot?

QUESTION ID:116

Bicoid was identified as a head morphogen in Drosophila and embryos lacking Bicoid could not form a head. In an experiment, bicoid mRNA was introduced in different regions of bicoid-deficient (bed·) or wild type embryos and development of the head and tail (as indicated by arrows) was followed


Which one of the following options represents the correct developmental pattern? 

QUESTION ID:117

Column X enlists some of the common animal viruses and column Y enlists cell surface proteins that serve as their receptors.

Column X

Column Y

A. Hepatitis A virus

i. Immunoglobulin superfamily

B. Rotavirus

ii. Acetylcholine receptor on neurons

C. Polio virus

iii. Alpha 2-macroglobulin

D. Rabies virus

iv. Acetylated sialic acid on glycoprotein

Which one of the following options represents the correct match between columns X and Y? 

QUESTION ID:118

An ancestral sequence (TT AG) has diverged into two sequences and has since accumulated nucleotide substitutions along two lineages (1 and 2)

Match the type of substitutions observed in the two sequences with their correct names:

QUESTION ID:119

Nutrients are gained or lost by ecosystems in a variety of ways. These nutrients may accumulate in different organic or inorganic pools over time. The different pools of phosphorus are
i. Mineral inorganic phosphorus
ii. Labile (available) phosphorus
iii. Occluded inorganic phosphorus
iv. Soil organic phosphorus
v. Plant organic phosphorus
The following graph shows the generalized change in phosphorus dynamics during primary succession: 
Which one of the following options correctly matches the region (A to E) shown in the graph to the phosphorous pool? 

QUESTION ID:120

The functional connection between the cell body of neuron and its axonal terminal is achieved by axonal transport. Some features of axonal transport are suggested in the following statements:
A. Orthograde transport occurs from the axonal terminal to the cell body.
B. Orthograde transport has two components - fast axonal transport and slow axonal transport.
C. The rate of orthograde fast axonal transport is higher than that of retrograde transport.
D. The molecular motor dynein is required for orthograde transport while kinesin is molecular motor for retrograde transport.
Which one of the following options represents the combination of correct statements?

QUESTION ID:121

Microtubule cytoskeleton utilizes some accessory proteins to regulate microtubule dynamics. Accessory proteins are given in column X and their typical functions in column Y

Accessory protein (Column X)

Function (Column Y)

A. γ-TuRC

(i) stabilizes plus end, promotes rapid microtubule growth

B. XMAP215

(ii) helps in microtubule branching

C. Katanin

(iii) nucleates assembly and remains associated with the minus end

D. Augmin

(iv) severs microtubules

Which one of the following options represents all correct matches between Column X and Column Y? 

QUESTION ID:122

The gametophytes of liverworts have the following types of apical cells, which contribute to different thallus forms:
A. Tetrahedral
B. Cuneate
C. Lenticular
D. Hemidiscoid
Which one of the following options correctly states the number of cutting faces (planes) each apical cell type has?

QUESTION ID:123

The figure given below is of two homologous chromosomes paired during meiosis where one event of recombination occurred between two homologues: 

The following interpretations were made:

A. The individual is heterozygous for an inversion

B. The figure depicts a paracentric inversion

C. After recombination at Anaphase I a dicentric and an acentric chromosomes will be formed

D. At Anaphase II the recombinant chromatids will have large deletion or duplication

E. Inversions are often considered as crossover suppressors because crossover product does not survive

Which one of the options given below has all correct answers:

QUESTION ID:124

Synthesis of thyroid hormones (T 3 and T4) takes place in a highly intricate manner in the thyroid gland. Following statements are made regarding synthesis of these hormones
A. Iodine enters the thyroid follicular cells through a transporter
B. Thyroid hormone synthesis takes place outside the follicular cells in the follicular colloid
C. Thyroglobulin glycoprotein is composed of four large subunits
D. Thyroglobulin glycoprotein is composed of two large subunits
Which one of the following options has the combination of correct statements?

QUESTION ID:125

Following statements were made for fragile X syndrome:
A. It is caused due to increased numbers of CGG trinucleotide (>200 repeats) in the 5' UTR of FMR1 genes.
B. Unaffected people do not show any CGG repeats in the 5' UTR of the FMR1 gene.
C. Expanded numbers of CGG repeats in 5' UTR of FMR1 transcripts causes its premature degradation.
D. Expansion over 200 repeats leads to methylation of the FMR1 promoter.
E. Fragile appearance of X chromosome develops due to dissociation of non-histone proteins from the FMR1 locus.
Which one of the following options provides combination of all correct statements?

QUESTION ID:126

The following steps/events represent the pathway of presenting extracellular pathogen to cytotoxic T cells:
A. Fusion of endosome membrane with the virus and escape of RNA and protein in the cytosol.
B. Assembly of class I MHC protein with bound viral peptide in Golgi apparatus.
C. Proteolysis of viral proteins by the proteasome.
D. Binding of the peptide to a chain and stabilization of the assembly of a chain and ~2- microglobulin.
E. Recognition of viral peptide by cytotoxic T cell.
Which one of the following options is the correct sequence of events?

QUESTION ID:127

The eukaryotic mRNA shown schematically in the diagram below has five ribosomes carrying out translation



Which one of the following statements about this polyribosome complex is true?

QUESTION ID:128

Following are certain statements regarding the plant cell water potential (1J1):
A. The major factors influencing the water potential in plants are potentials of solutes ('l's), pressure (\Vp) and gravity ('l'9).
B. The solute potential (1J1s) increases the free energy of water by diluting the water.
C. Positive pressures raise the water potential while negative pressures reduce it.
D. The gravitational potential depends on the height of the water above the reference-state of water, the density of water and the acceleration due to gravity.
Which one of the following options represents all correct statements?

QUESTION ID:129

The following DNA molecules are provided as substrates for replication by DNA polymerase Ill

Which one of the following options lists the molecules that CANNOT function as substrates for DNA polymerase Ill?

QUESTION ID:130

Newly identified proteins X, Y, and Z are associated with endoplasmic reticulum (ER) membrane fraction. The above ER membrane fraction is subjected to high salt treatment {buffer pH 7.4, 0.5 M KCI) followed by fractionation by centrifugation into soluble and insoluble pellet
components. The following observations were made from the above experiment:
i. The proteins X and Y are fractionated into soluble components.
ii. Protein Z is fractionated into insoluble pellet components.
Based on these observations, the following inferences are made:
A. Proteins X and Y are peripheral membrane proteins
B. Protein Z is an integral membrane protein
C. Protein Z is a peripheral membrane protein
D. Proteins X and Y are integral membrane proteins
Which one of the following options represents the combination of all correct statements?  

QUESTION ID:131

Columns X and Y list the terms associated with gametogenesis and fertilisation


Column X


Column Y

A

Primordial germ cells

i

Luteinizing hormone

B

 Dictyate resting stage

ii

Posterior epiblast

C

 Sodium channels

iii

Male pronuclei

D

 Protamines

iv

Block polyspermy

Which one of the following options represents all correct matches?

QUESTION ID:132

Angiosperms have witnessed evolutionary changes which includes a few apomorphies. Which one of the following options depicts the correct apomorphy/apomorphies that has/have evolved in Eudicots?

QUESTION ID:133

The reproductive cycles of two populations (X and Y) of the silk cotton tree ( Ceiba pentandra) were monitored for one year. A census was carried out and all plants were tagged and counted throughout this period and is reflected in the data sheet given below

Parameter

Population X

Population Y

Initial number of plants (N0​)

500

300

Number of new seedlings established (B)

100

210

Number of initial plants that died (D)

20

27

Given that there is no seedling mortality, which one of the options correctly depicts the per capita rate of increase (r) for the two populations?

QUESTION ID:134

As depicted in the figure below, the sequence of trypanosomal mitochondrial cytochrome oxidase subunit II (COX 11) mRNA does not match the sequence of the COX II gene. The mRNA contains four additional U's (highlighted) which are not represented by 'T's in the gene, and these four U's are presumably added to the RNA by editing
COX II DNA: ... GT AT MAAGT AGA G A ACCTGG···
COX II RNA: ···GUAUMAAGUAGAUUGUAUACCUGG···
The following statements were made about RNA editing:
A. RNA editing can add or remove U's from the target mRNA.
B. Editing occurs in the 5' - 3' direction by successive action of one or more guide RNAs.
C. A terminal uridylyl transferase (TUTase) facilitates addition of extra UMPs (urldylates) to the mRNA during editing.
D. The proteins required for editing are encoded by the mitochondrial DNA, while the required guide RNAs are encoded in the nucleus and imported into the mitochondria.
Which one of the following options shows the combination of all correct statements?

QUESTION ID:135

Certain statements are made below regarding radio-receptor assay technique
A. It is a competitive protein binding method.
B. It is a non-competitive protein binding method.
C. Radiollgand is present in excess of unlabelled ligand.
D. Unlabelled ligand is present in excess of radioligand.
E. Activated charcoal incubation and further centrifugation lead to separation of free ligand in the charcoal pellet.
F. Activated charcoal incubation and further centrifugation lead to separation of bound ligand in the charcoal pellet
Which one of the following options is the combination of all correct statements?

QUESTION ID:136

Given below is a DNA sequence:
5' - ATGCGATGACGATTGACGATGACGATAGAC - 3'
In the absence of any other affecting parameters such as length, Tm, GC-content, which one of the following combinations of PCR primer sequences would be able to amplify the above fragment?

QUESTION ID:137

The table given below contains some of the classes of phylum Arthropoda in Column X and their characteristic head structures in Column Y


Column X


Column Y

A.

Arachnida

i.

Head is distinct with a pair of compound eyes, a paired antennae, a paired mandibles and a paired maxillae

B.

Crustacea

ii.

Head is distinct having a pair of simple eyes, paired antennae and paired mandibles

C.

Myriapoda

iii.

Five segmented head with two pairs of antennae, two pairs of maxillae and one pair of mandibles

D.

Insecta

iv.

Cephalothorax with two chelicerae, two pedipalps

Which one of the following options represents the correct match between Column X and Column Y? 

QUESTION ID:138

Following statements are made regarding heterosis breeding in plants.
A. Heterosis is always lowest in a cross between two genetically diverse parents.
B. Cytoplasmic Male Sterility (CMS) may be used in heterosis breeding to eliminate emasculation.
C. The A-line (CMS) and B-line (used for maintenance of CMS) are isogenic lines, differing at only a specific locus.
D. Heterosis can be retained in the F2 generation.
Which one of the following options represents the combination of all correct statements?

QUESTION ID:139

Yeast two-hybrid system allows detection of interacting proteins. In the following schematic, various components of yeast two-hybrid system have been indicated by letters A-F.

Which one of the following options provides a correct match of A to F and components of yeast two-hybrid system? 

QUESTION ID:140

The table below lists terminologies (column X) and concepts (column Y) related to ecological niche


Column X


Column Y

A

Niche complementarity

i

Species distribution explained by trophic levels and biotic interactions.

B

Niche packing

ii

Tendency for coexisting species which occupy a similar position along at least one niche dimension.

C

Community niche

iii

Tendency for coexisting species to fill the available space along important niche dimensions.

D

Eltonian niche

iv

Composition of niches of all individual species niches that co-occur at the same site.

Which one of the following options represents the correct match between column X and column Y?

QUESTION ID:141

Certain animal species use infrasound for acoustic signaling. In this context, consider the statements below:
A. lnfrasound signals propagate over several kilometers in deserts
B. lnfrasound signals propagate over several kilometers in open oceans
C. lnfrasound is employed only by mammals for acoustic signaling.
D. lnfrasound signal transmission is prone to scattering and attenuation
Which one of the following options represents all correct combination about infrasound signaling?

QUESTION ID:142

The melting curves shown below are of two double-stranded DNA molecules of the same length

Which one of the following statements about these DNA molecules is correct?

QUESTION ID:143

Protein transport into the ER is co-translational and proteins are inserted via an aqueous channel into the ER. This can be studied using microsomes in an in vitro translation set up. Statements given below are possible outcomes when salt conductance is measured in this system.
A. Microsomes do not show any conductance of salt ions when isolated from the cells.
B. Addition of puromycin will lead to increased salt conductance.
C. Addition of puromycin will have no effect on salt conductance.
Which one of the following options has the combination of all correct statements?

QUESTION ID:144

The following statements are made regarding the defense signaling pathways locally activated following pathogen infection or pest attack
A. When JA1LE levels rise, the JAZ proteins interact with COl1 protein and get degraded by 26S proteasomal pathways.
B. Elevated reactive oxygen species levels enhance SA-mediated defense signaling.
C. Under normal (uninfected) conditions, NPR1 is preferentially localized into the nucleus
D. Gibberellic acid and abscisic acid cannot participate in plant defense signaling
Choose the option with all correct statements:

QUESTION ID:145

The table below represents plant disease resistance genes, the protein type and race-specific nature:

Disease resistance gene

Protein type

Race-specific nature

A. edr1

a. subunit of the general transcription factor TFIIA

i. yes

B. mlo

b. Raf-like MAPKKK

ii. no

C. xa5

c. a member of the NODULIN3 gene family of SWEET proteins

D. xa13

d. plant-specific seven transmembrane helices protein

Choose the correct combination of disease resistance gene, its protein type, and race-specific nature from the options given below.