Previous Year Questions

Performance Meter

0%

TLS Online TPP Program

QUESTION ID:1

In Bayesian statistics, A and ft: correspond to different hypotheses, H1 and H2, and D corresponds to the observed data (X)
An equation for hypothesis H1 can be given as P(H1 ID = 
Given below are statements related to the above equation
A. The equation represents the conditional probability of hypothesis H1, given the data.
B. The equation represents the probability of the data, given the hypothesis.
C. P(XIH1) is called a prior probability, which is assigned to the hypothesis before the data is observed or analysed.
D. P(XIH1) represents the likelihood under the hypothesis H1 

QUESTION ID:2

Certain statements are put forth on the regulation of renal blood flow and are given below.
A. Norepinephrine dilates the renal vessels.
B. Dopamine causes renal vasodilation and natriuresis.
C. Angiotensin II exerts a constrictor effect.
D. Prostaglandins decrease blood flow in the renal cortex and increase it in the medulla.
E. Acetylcholine produces renal vasodilation
Choose the option with the combination of all correct statements

QUESTION ID:3

Given below are certain statements regarding the light absorption by chlorophyll pigment molecule in a green leaf.
A. The absorption of a photon by a pigment molecule converts it from its lower state to an excited state.
B. Internal conversions or relaxations of pigments convert higher excited states to the lowest excited state, with a concern itant loss of energy as heat
C. The light reemitted from the lowest excited state of chlorophyll molecule is fluorescence.
D. Red light absorption by chlorophyll molecule results into higher excitation state relative to the blue light absorption.
Which one of the following combinations is correct?

QUESTION ID:4

Given below is the structure of a gene whose transcrription is terminated in a Rho-independent manner. When the terminator is operational, the short transcript of 150 bases is formed and when it is not operational, a longer transcript of 200 bases is formed. A researcher generated several mutations in the terminator region and examined the transcripts obtained
The manipulations done are:
A. Three nucleotides of the string of 8Ts were replaced by GCC.
B. The 8T sequence was transferred to the template strand.
C. The sequences that generate the paired stem were altered to disrupt pairing.
D. The sequences that generate the paired stem were altered to disrupt pairing, followed by introduction of compensatory mutations to restore
pairing
Choose the option that correctly predicts the potential transcript size in each of these cases

QUESTION ID:5

Mechanism of primary sex determination is best known in Drosophila and mammals. Given below are statements in regard of sex determination in these two model systems
A. In Drosophila, if sry gene product is present, it may block betacatenin signaling and along with SF1 , activate the sox9 gene.
B. In mammals, an alternate splicing of Sxl transcript that removes a stop codon and allows formation of a functional protein, is responsible for
initiating the female sex determination.
C. A trans-splicing event in Tra transcript results in formation of functional Tra protein in Drosophila.
D. XO individuals in Drosophila are males while, XXY individuals are females
Which of the above statements are correct?

QUESTION ID:6

Following statements were made about initiation of translation in eukaryotes
A. The elF2 facilitates correct recognition and binding of ribosomal subunits.
B. The elF2B activates elF2 by replacing its GDP with GTP
C. The elF3 binds to the 60S ribosomal subunit and inhibits its reassociation with the 40S subunit.
D.elF5 promotes association between the 60S ribosomal subunit and the 48S complex
E. The elF6 binds to the 60S ribosomal subunit and blocks reassociation with the 40S subunit.
Which one of the following options shows combination of all correct statements?

QUESTION ID:7

Given below are statements related to different types of natural selection models.
A. Directional selection changes the average value of a trait.
B. Stabilizing selection increases variation in a trait.
C. Disruptive selection reduces variation in a trait.
D. Balancing selection maintains variation in a trait.
Select the correct option that represents the combinations of statements that are NOT true about natural selection

QUESTION ID:8

The following proposed statements describe some aspects of thermoregulation
A The basal metabolic rate is rapidly adjusted in the thermoneutral zone to maintain temperature homeostasis.
B. The homeotherms who have the ability to hibernate, do not maintain normal physiological temperature range during hibernation.
c. The thermoregulatlon Is not regulated by hypothalamus.
D. Warm-blooded animals require more food compared to cold-blooded animals of the same size and weight
Which one of the following options represents combinations of all correct statements?

QUESTION ID:9

The following proposed statements describe some aspects of thermoregulation.
A The basal metabolic rate is rapidly adjusted in the thermoneutral zone to maintain temperature homeostasis.
B. The homeotherms who have the ability to hibernate, do not maintain normal physiological temperature range during hibernation.
c. The thermoregulatlon Is not regulated by hypothalamus.
D. Warm-blooded animals require more food compared to cold-blooded animals of the same size and weight

QUESTION ID:10

A transgenic line was developed in mustard. The TO transgenic line was selfed and the insertion of transgene was analyzed in the parental (P) and progeny lines (1 to 5). The T-DNA region (between left (LB) and right (RB) borders) used for transformation is outlined in Figure A. The pattern following Southern hybridization using probes A and B is represented in Figure B. Genomic DNA was digested with EcoRI (E). The thickness ofband indicates the intensity of hybridization
The following statements were made based on the above observation:
A. The developed transgenic line has a single copy of T-DNA.
B. The absence of band in progeny 4 is due to incomplete transfer of the
T-DNA during transformation.
c. Progeny 2 Is homozygous at the site of Insertion.
D. All selfed progeny of line 5 is expected to show hybridization with both probes A and B
Which one of the following options has all of the correct statements?

QUESTION ID:11

Given below are the list of plant hormones (Column X) and their biosynthesis precursors (Column Y)

Column X

Column Y

A. Auxins

i. Geranylgeranyl diphosphate

B. Cytokinins

ii. Adenosine moiety

C. Ethylene

iii. Tryptophan

D. Gibberellins

iv. 1-aminocyclopropane 1-carboxylic acid

Which one of the following options represents the correct match between column X and Y?

QUESTION ID:12

The cAMP-PKA-CREB pathway regulates many important biological processes, from hormone synthesis to inducing long-term memory in the brain. The following statements describe the effects of mutations in the components of the pathway on gene transcription by CREB
A. Loss of function mutation in a cAMP binding site of the PKA regulatory subunit leads to the inactivation of gene expression
B. Activating mutation in the GTP-binding domain of the a subunit of Gs leads to the activation of gene expression
C. Inactivating mutation that prevents the regulatory subunit of PKA to bind the catalytic subunit leads to the activation of gene expression.
D. Inactivating mutation in the PKA phosphorylation site of CREB leads to the activation of gene expression.
Which one of the following statements is INCORRECT?

QUESTION ID:13

The following represents a Southern hybridization of restricted genomic DNA, probed with a DNA fragment corresponding to gene 'Z'. 'Z' is a single copy gene. The hybridization patterns of parents and their progeny have been presented
Which one of the following options is a correct interpretation of the observation?

QUESTION ID:14

Which one of the following nucleic acids with same concentrations in water, will form a stable stem-loop structure upon annealing by heating and flash cooling on ice?

QUESTION ID:15

Given below are species concepts (Column X) and their descriptions (Column Y):


Column X


Column Y

A.

Typological species concept

i.

Single lineage of ancestor-descendant populations which maintains its identity from other such lineages

B.

Biological species concept

ii.

A species is a set of organisms that resemble one another and is distinct from other sets.

C.

Evolutionary species concept

iii.

Species are groups of interbreeding natural populations that are reproductively isolated from other such groups

D.

Phylogenetic species concept

iv.

A group recognised by its monophyly

Which one of the following options represents all the correct matches?

QUESTION ID:16

Based on theoretical concepts of mating systems in plants, pollen : ovule ratios are likely to be most skewed in which one of the following cases?

QUESTION ID:17

Given below are statements about the Kallmann syndrome.
A. It is a condition of hypogonadotropic hypogonadusm.
B. There is a loss of sense of smell in such individuals.
C. This syndrome is most common in women.
D. It happens due to mutation of the KALIG1 gene on X-chromosome thatcodes for an adhesion molecule necessary for the normal development of the gustatory nerve
Which one of the following options has the combination of all correct statements?

QUESTION ID:18

P aeruginosa makes a blue-green pigment called pyocyanin. To understand the pyocyanin biosynthetic pathway, mutants which cannot make pyocyanin were isolated. Six such mutants are crossed with eacother and the data is given below:
- is pyocyanin negative; + pyocyanin positiveBased on this data, can you predict how many genes are responsible for the pyocyanin production?

QUESTION ID:19

A portion of an mRNA encoding a protein is shown below, with the start codon underlined.
5' ... CCUCAAACAGACACCAUGUUGCACCUGACUCCU ... 3'

Which one of the following tRNAs is most likely used for translating the second codon in the open reading frame of the protein?
    

QUESTION ID:20

Photorespiration or C2 cycle takes place in three distinct organelles in the plant cells. Following are certain statements related to the C2 cycle.
A Reduced ferredoxin and ATP are required for photorespiration and assimilation of resulting NH3.
B. Photosynthetic electron transport provides energy rich ATP and NAPDH for photorespiration.
C. Glutamate is translocated from chloroplast to peroxisome, while aketoglutarate is translocated from peroxisome to chloroplast.
D. The action of enzyme serine hydroxymethyl transferase takes place in peroxisome.

Which one of the following combinations has all correct statements?

QUESTION ID:21

Bacteria employ various mechanisms to invade or enter host cells, whichare either phagocytic or non-phagocytic in nature. Given below are some of the mechanisms which are generally used for carrying out this process
A. Some bacteria express a protein called invasin tlhat is recognized by host-cell ~ 1 integrins.
B. Actin polymerization along with assembly of clathrin coat results in the internalization of bacteria by zipper mechanism.
C. Some bacteria, including Salmonella enterica, use trigger mechanism to inject a set of effector molecules in the cytosol through type 111 secretion system.
D. Some bacteria attach to host cell surface receptors inducing local elevation of Ca2+ in cell cytosol, leading to the fusion of lysosomes with bacteria containing plasma membrane vesicles

Which one of the following represents the combination of correct mechanisms for invading non-phagocytic cells?

QUESTION ID:22

The following table lists habitat type (Column X) and geographic regions (Column Y) where they can be found:


Column X


Column Y

A.

Mangroves

i.

Western Ghats

B.

Terai

ii.

Banni

C.

Laterite plateaus

iii.

Sunderbans

D.

Arid grasslands

iv.

Himalayan foothills

E.

Shola


Which of the following options represents the correct match between column X and Y?

QUESTION ID:23

Following are marker enzymes that would be used to identify correct subcellular fractions


Column X


Column Y

A.

Lactate dehydrogenase

i.

Lysosomes

B.

Acid phosphatase

ii.

Microsomes

C.

Glucose-6-phosphatase

iii.

Cytosol

D.

Catalase

iv.

Peroxisomes

Which one of the following options correctly pairs the enzymes with the subcellular fractions?

QUESTION ID:24

The following statements pertain to limb development in chick. Each statement describes an experiment and the expected outcome.
A. Targeted loss of retinoic acid synthesis in the forelimb causes a reduction of Tbx4 expression and the failure to form forelimbs.
B. When Fgf10 _secreting be?ds are placed at a somite level that induced limb bud expressing Tbx5 in the anterior and Tbx4 in the posterior part, a chimeric limb can be formed.
C. Constitutive activation of FGF receptors results in the loss of forelimb field, demonstrating that expression of Fgf8 functions to inhibit forelimb development
Which one of the following option(s) is/are correct?

QUESTION ID:25

An oligopeptide is subjected to amino acid analysis and found to have the following composition
Tyr, Phe, Asp, Val, Arg, Met
The following statements represents/outline/list the results obtained after analysis:
A. The above oligopeptide is subjected to N-terminal Edman degradation, revealing Tyrosine residue.
B. Trypsin treatment did not affect the peptide.
C. Cyanogen bromide treatment yielded a dipeptide, tetrapeptide, and free Arginine.
D. Chymotrypsin treatment yielded dipeptide and tetrapeptide. The composition of tetrapeptide was Valine, Arginine, and Methionine.
Based on above observations, what is the CORRECT sequence of heptapeptide?

QUESTION ID:26

Apoplast phloem loading is determined by the cellular location and transport function of the membrane-bound proteins. Following are certain statements regarding these proteins
A. SWEETs are the sugar transporter proteins and are capable of transporting only sucrose and not glucose.
B. Double mutants of Arabidopsis SWEET11 and SWEET12 results in carbohydrate accumulation in the source leaves and slower export of the
photoassimilates.
C. H+-symport mechanism loads sucrose or polyols into Sieve Element (SE)/Companion Cell (CC) complexes.
D. Several clades of sucrose/H+ symporters (SUTs. or SUCs) are localized to plasma membranes of minor vein SE/CCs and participate in apoplastic loading.
Which one of the following combinations is correct?

QUESTION ID:27

The statements below attempt to describe a few characteristics of Alu repeats found in the human genome
A. Alu elements are a class of short interspersed elements (SINEs)
B. SINEs are autonomous transposons
C. Alu repeat originated from cDNA copies of ?SL RNA
D. Alu repeats have a rela tively high AT content
E. They are preferentially located in the gene-poor G chromosome bands.
Which one of the following options shows combination of all correct statements?

QUESTION ID:28

Synchronous cultures of MCF7 breast cancer cells were grown and treated  with the following:
(i) buffer (plate was named MCF7),
(ii)_an inhibitor of Cyclin D (plate was
named MCF7.1), and
(iii) siRNA designed against Cyclin B1 (plate was named MCF7.
Following this, the cells were stained and sorted using flow cytometry. The relative amount of DNA in each of the three phases of the cell cycle (G1, S, G2/M in arbitrary units) were plotted against the number of cells, as
shown below.

Which one of the following options correctly represents all the cell cycle states of MCF7, MCF7.1 and MCF7.2?

QUESTION ID:29

A new strain of bacteria was created by introducing an artificial operon, to allow bacterial cells to grow in the presence of iron. The Fe++ operon consisted of genes that made the cells capable of tolerating increased iron. For efficient functioning of this operon, the following desirable features were considered.
Which one of the following can be used to develop this operon?

QUESTION ID:30

Which one of the following Newick trees represents the correct relationship between apes.

QUESTION ID:31

The structure and process of formation of different antigens in blood ABO system are given in the following statements:
A. Galactose is added to the terminal of H-antigen lby a transferase expressed in individuals with type A blood.
B. The B antigen is formed by a transferase expressed in individuals with type B blood which adds a terminal N-acetylgalactosamine to H-antigen.
c. The H-antigen is formed by fucose transrerase that adds a terminal fucose to its precursor.
D. The H-antigen is the precursor of both the A- and B- antigens and it is the blood group antigen in persons of type O blood.
Which one of the following options represents the correct combination of statements?

QUESTION ID:32

The following statements are suggested regarding the principle and uses of positron emission tomography (PET):
A The PET scanner is a positron ray detector.
B. The PET scanner cannot determine the location of collision between positron and electron in the brain.
C. The typical PET aciivation studies can measure the absolute metabolic activity of brain.
D. In PET, a radioactive isotope is introduced into blood as 'tracer' that rapidly decays by emitting a positron from their atomic nuclei.
Which one of the following options represents the combination of correct statement(s)?

QUESTION ID:33

In a study comparing different plant communities (A to D) across a landscape, the following data were obtained:


Which one of the following options represents the pair of communities with highest similarity value when Sorenson's coefficient is used?

QUESTION ID:34

The table below lists phylogenetic reconstruction methods and the description of these methods, which includes both algorithmic and optimality-based methods or criteria\


Method (Column X)


Description (Column Y)

A.

Maximum parsimony

i.

Tree length, that is sum of branch lengths, often estimated by least squares.

B.

Minimum evolution

ii.

Minimum number of changes, minimised over ancestral states

C.

Bayesian

iii.

Cluster algorithms to arrive at a single tree.

D.

Neighbour Joining

iv.

Posterior probability, calculated by integrating it over branch lengths and substitution parameters

Select the option that best matches the tree reconstruction method (Column X) with its correct description in Column Y

QUESTION ID:35

The table below represents some protein modifications in Column X and their functions in Column Y

Column X

Column Y

Protein modification

Function

a. Palmitoylation

i. Protein degradation

b. polySUMOylation

ii. Membrane anchoring

c. Glycosylphosphatidylinositol

iii. Lysosomal targeting

d. Mannose-6-phosphate

iv. Protein folding

Which one of the following options represents all correct matches between Column X and Column Y?

QUESTION ID:36

The central rod domain of keratin protein is 300 amino acids in length. What is the approximate length (in A) of the rod domain if the peptide consists of
i) distorted a-helix
ii) true a-helix
iii) anti-parallel j3-sheet

QUESTION ID:37

In an experiment using nude mice, the population is divided into two groups, A and B. Group A mice are injected with T cells from normal mice and Group B mice are left untreated. Both the groups are then immunized with LPS. Which one of the following statements regarding antibody production in groups A and B is most likely to be true?

QUESTION ID:38

In birds and mammals, 3rd, 4th and 6th aortic arches persist in adult animals with some structural modifications. Which of the following modified organization is correct?

QUESTION ID:39

Unknown antigens can be detected or measured by a sandwich ELISA whereas Elispot assays measure the number of cells capable of secreting particular molecules such as cytokines which is considered as antigens.
Which of the following is true for both assays?

QUESTION ID:40

Iron (Fe) is taken up by cells via receptor-mediated endocytosis utilizing transferrin and transferrin receptor. In a cell line with a mutation in the transferrin receptor that is unable to interact with transferrin at pH (4-6),
which one of the following steps will be first affected in this pathway?

QUESTION ID:41

Consider a highly diverse community of closely related species of lizards which has evolved in a short period of time and that occupies different ecological niches in peninsular India. What type of speciation process can
explain the above pattern?

QUESTION ID:42

Defending a territory is energetically expensive and animals should invest in this only if it is profitable A sunbird species is dependent on a plant species that contains nectar-rich flowers, making it an important resource for the sunbird. Males may defend territories containing these plants against other males, while allowing females to access the flowers. In this way they keep competitors out and get access to the females.
The columns below (P to S) represent characteristics of the resources and their variants (i and ii)

Column P

Column Q

Column R

Column S

Abundance of flowers in the habitat

Distribution of flowers in the habitat

Nectar depletion rate of flowers

Nectar renewal rate of flowers

i. High

i. Uniform

i. High

i. High

ii. Low

ii. Patchy

ii. Low

ii. Low

From the given options, choose the combination of plant characteristics that makes defending a territory most profitable for males

QUESTION ID:43

Extracellular matrix comprises of various proteins and polysaccharides that assemble into an organized meshwork. This associates with the cells that produce them. Given below are a few statements regarding different components of the matrix.
A. Collagen is the major protein of the extracellular matrix and is a long, and triple-stranded helical structure.
B. Hyaluronan which is produced in large quantities during wound healing is a type of gIycosaminogIycan (GAG) that contains sulfated sugar and is covalently linked to the core protein.
C. Syndecans are plasma membrane proteoglycans that interact with the actin cytoskeleton and signaling molecules of the cell cortex.
D. Decorin is a small
Which one of the following options represents INCORRECT statement/s?

QUESTION ID:44

The characteristic features and causes of different heart sounds during a cardiac cycle of humans are given in the following statements
A. The second heart sound is loud and sharp when the diastolic pressure is decreased in the aorta or pulmonary artery.
B. Sudden closure of atrioventricular (AV) valves at the start of ventricular systole caused vibration that produces first heart sound.
c. The second heart sound is caused by the vibration associated with the closure of aortic and pulmonary valves after the end of ventricular systole.
D. The first heart sound is soft when heart rate is low as the ventricles are well filled with blood and the leaflets of AV valves float together before systole.
Which one of the following options represents the combination of all correct statements?

QUESTION ID:45

Selected human diseases and their vectors are listed below:

Column X

Column Y

Disease

Vector

A. Chikungunya

i. Aedes mosquito

B. Lyme disease

ii. Anopheles mosquito

C. Lymphatic filariasis

iii. Aquatic snails

D. Schistosomiasis

iv. Ticks

Which one of the following options represents the correct match between column X and column Y?

QUESTION ID:46

You have purified an enzyme that has a molecular weight of 60 kDa. You run this protein on an SOS-PAGE gel and get the following results
Which of the following statements is valid for the quaternary structure of this enzyme?

QUESTION ID:47

Figure A represents the sites for Ncol (N) in a binary vector pCSIR2023. The vector is 16500 bp in size. Figure B represents the fragments observed when the vector is either digested with Ncol (N) or double digested with Hindlll and Ncol (H+N). The intensity of fluorescence of the 453 bp fragment is double that of the 516 bp fragment
Which one of the following statements regarding the numbers and location(s) of Hindlll site is correct?

QUESTION ID:48

Which one of the following statements about change in temperature with elevation is correct?

QUESTION ID:49

The sensory nerve fibers (Column X) and the sensory receptors connected to different sensory nerves (Column Y) are given below

Column X

Column Y

Sensory nerve fibre

Sensory receptor

A. Ia

i. Muscle spindle, flower spray ending

B. Ib

ii. Pain and cold receptor

C. II

iii. Muscle spindle, annulo-spiral ending

D. III

iv. Golgi tendon organ

Which of the following options represents the correct match between column X and column Y?

QUESTION ID:50

In DNA foot-printing,
A The DNA is labelled by random priming so that the entire DNA is labelled and one does not miss out any region that binds with the given protein.
B. The DNA is end-labelled so that the bands get organized from higher to lower size after electrophoresis and autoradiography.
C. A sequencing polyacrylamide gel is used to resolve all the fragments distinctly.
D. A higher concentra1ion of agarose gel is used to resolve the finer bands.
Which one of the following options has the combination of all correct statements?

QUESTION ID:51

Given below are statements about development in d ifferent model organisms
A. Xenopus egg has yolk and hence undergoes meroblastic cleavage.
B. Embryonically transcribed beta-catenin in the blastomeres of sea urchin embryos regulates the autonomous specification of micromeres.
C. The sodium pump activity in the trophoblast helps in the formation of blastocoel of a mammalian blastocyst.
D. Prevention of tubal pregnancy is one of the major functions of zona pellucida in humans.
Which combination of the statements is true?

QUESTION ID:52

Epistasis is observed between different genes in flower color of sweet pea. A red variety on selfing yields red:white in ratio 9:7. The precursors and intermediates give white color. The following biochemical pathways were
proposed for the above observations:
Which one of the options represents the correct pathway(s) that explains the observations?

QUESTION ID:53

Match the names of scientists (column X) with the ecosystem concepts (column Y) they are known for:

Column X

Column Y

A. Charles Elton

i. trophic dynamics

B. A G Tansley

ii. the term ecosystem

C. A J Lotka

iii. pyramid structure of feeding relationships in ecosystems

D. Raymond Lindeman

iv. a thermodynamic view of the ecosystem

QUESTION ID:54

In C. elegans, PAR proteins segregate at the cell cortex in the zygote to establish cell polarity. This is dependent on the regulation of the cortical actin cytoskeleton by RhoA. An investigator sought to directly inhibit actin polymerization to analyze the impact of this inhibition on PAR protein localization. Which one of the following chemicals would be the most suitable

QUESTION ID:55

This is a hypothetical example. In a plant, a single gene governs flower color. The wild type color is red, while the mutant is white. It was demonstrated that insertion of a transposable element caused the white phenotype. In a PCR test, a set of primers outside the site of insertion is used to amplify the genomic DNA and the PCR products are resolved by Agarose gel electrophoresis. A geneticist made a cross between two plants. 30 progeny from the cross was analyzed by PCR. Each lane in the gel below represents analysis of one progeny
Based on the above, which one of the following statements is correct?

QUESTION ID:56

The amino acid sequence of tetrapeptides (P, Q, R) is shown below.
P) Asp-Gly-Asp-Ser Q) Gly-Ser-Arg-Gly R) Gly-Lys-Arg-Ala
i. Calculate the net charge on the above tetrapeptides at pH 7.0
ii. If the mixture of the above tetrapeptides is separated on a cationexchange
column at pH 7.0, which tetrapeptide will elute last?
Choose the correct answer given below.

QUESTION ID:57

The figure below depicts the reflectance curves of different features found in an urban ecosyste
Which one of the options below correctly identifies the reflectance curves?

QUESTION ID:58

What is the V0!Vmax ratio for an enzymatic reaction when [SJ= 3 Km and 9 Km, respectively?

QUESTION ID:59

By expressing the EGF-like ligand LIN-3, the c. e/egans anchor cell (AC) directly triggers vulval development. LIN-3 acts at a distance and has a graded action. The levels of LIN-3 can be controlled by using various
genetic techniques.

Which one of the following options is a correct match between column I and column II?

QUESTION ID:60

The following statements describe the developmental processes during different modes of reproduction in angiosperms:
A. In double fertilization, one sperm fuses with the egg and other with the central cell to form the zygote and endosperm, respectively.
B. In sporophytic apomixis, a diploid cell gives rise to the next generation thereby maintaining the maternal genotype.
c. In gametophytic apomixis, a reduced egg cell forms apomictic embryo through parthenogenesis.
D. In pseudogamy, the functional endosperm is formed without fertilization

QUESTION ID:61

Researcher plans to study protein trafficking into the endoplasmic reticulum (ER). For this purpose, they plan different experimental conditions shown below:
A. The cytosol is mixed with mRNA that codes for a secreted protein, followed by wesiern blotting with antibodies against secreted protein.
B. The cytosol is mixed with mRNA that codes for a secreted protein and rough microsomes, followed by western blotting with antibodies against secreted protein.
C. The cytosol is mixed with mRNA that codes for a secreted protein and rough microsomes followed by protease treatment. Subsequently, western blotting with antibodies against secreted protein is done
Consider that mRNA that codes for a secreted protein is added in abundant amount, which experimental control/s would be the best to confirm the polypeptide entry into the ER?

QUESTION ID:62

A mutant strain of E.coli having defects in one of the DNA repair pathways was identified. To identify the pathways where mutation occurred, aresearcher looks at the following parameters and identified the defect to be
in base excision repair pathway
A. Topoisomerase 11 enzyme activity
B. AP endonuclease activity
c. Expression ot mutL and muts
D. DNA glycosylase activity
E. DNA ligase activity
Based on the changes in which of the above parameters, this conclusion can be drawn?

QUESTION ID:63

The graph given below is based on the optimal foraging theory. If the Y axis represents "Cumulative Resource Intake" following tihe law of diminishing
returns, what do T and T' stand for?

QUESTION ID:64

The graph below depicts the net change in forest cover in four regions (AD) between 1990 and 2020, according to the FAO report - 'The State of World's Forests 2020'.
Which one of the following options correctly identifies these regions?

QUESTION ID:65

The Cre-LoxP system was used to knock-out the p53 gene from the mice lungs. An immunoblot analysis was carried out as shown below

The following assumptions were made
A. The LoxP system did not work since the recombinase was not functional.
B. The Lox P sites were introduced under a promoter specific for lungs.
C. The tissue-specified promoter selected was of the prostate gland.
D. The mice died because of being knocked out of p53.
E. The knocked-out mice developed mutagen-induced tumours in their prostate gland more rapidly than in their lungs
Which one of the following is correct combination of above assumption?