Previous Year Questions

QUESTION ID:2

Three strips of 10 m width each are placed along the equator (A 1), the Tropic of Cancer (A 2), and the Arctic Circle (A3 ), respectively. The relationship amongst the areas of the strips is

QUESTION ID:3

Which of the following values is same as ?

QUESTION ID:4

A man starts his journey at 0100 hrs local time to reach another country at 0900 hrs local time on the same date. He starts a return journey on the same night at 2100 hrs local time, taking the same time to travel back to his original place. If the time zone of his country of visit lags by 10 hours, the duration for which the man was away from his place is

QUESTION ID:5

The probability that a ticketless traveller is caught during a rip is 0.1. If the traveller makes 4 trips, the probability that he/she will be caught during at least one of the trips is:

QUESTION ID:6

The number of squares in the above figure is

QUESTION ID:7

If A says, “exactly one among B and C is a liar” and B says, “both A and C are liars”, then

QUESTION ID:8

It takes 2 hours for Tanu and Deo to do a job. Tanu and Hari take 3 hours to do the same job. Deo and Hari take 6 hours to do the same job. Which of the following statements is incorrect?

QUESTION ID:9

A person paid income tax at the rate of R% for the first Rs 2 lakhs, and at the rate of (R + 10)% for income beyond Rs 2 lakhs. If the total tax paid is (R + 5)% of the annual income, then what is the annual income?

QUESTION ID:10

Brothers Santa and Chris walk to school from their house. The former takes 40 minutes while the latter, 30 minutes. One day Santa started 5 minutes earlier than Chris. In how many minutes would Chris overtake Santa?

QUESTION ID:11

Wheat production of a country over a number of years is shown in the graph. Which year recorded the highest percent reduction in production over the previous year?

QUESTION ID:12

Based on the distribution of the cumulative percent surface area of the Earth at different elevations and depths (with reference to sea‐level) shown in the figure, which of the following is FALSE?

QUESTION ID:13

OA, OB and OC are radii of the quarter circle shown in the figure. AB is also equal to the radius.

QUESTION ID:14

if P+ 1/Q =1 and Q+ 1/R = 1, then what is PQR ?

QUESTION ID:15

If the product of three consecutive positive integers is equal to their sum, then what would be the sum of their squares?

QUESTION ID:16

A board has 8 rows and 8 columns. A move is defined as two steps along a column followed by one step along a row or vice‐versa. What is the minimum number of moves needed to go from one corner to the diagonally opposite corner? 

QUESTION ID:17

Time‐distance graph of two objects A and B are shown.

If the axes are interchanged, then the same information is shown by

QUESTION ID:18

A plate of 5m × 2m size with uniform thickness, weighing 20 kg, is perforated with 1000 holes of 5cm × 2cm size. What is the weight of the plate (in kg) after perforation?

QUESTION ID:19

Two runners A and B start running from diametrically opposite points on a circular track in the same direction. If A runs at a constant speed of 8 km/h and B at a constant speed of 6 km/h and A catches up with B in 30 minutes, what is the length of the track?

QUESTION ID:20

There are two gas parcels of equal volume, A and B at the same temperature and pressure. Parcel A is one mole of water vapour, while parcel B is one mole of day air. Which of the following is TRUE?

QUESTION ID:21

Phosphofructokinase catalyses one of the regulatory steps in glycolysis. Which one of the following metabolic changes leads to the activation of phosphofructokinase?

QUESTION ID:22

What is the net charge of the peptide Tyr‐Val‐Arg at pH 5.0?

The pK s of alpha amino and carboxyl groups are 9.6 and 2.3, respectively. The pK s of Tyr and Arg side chains are 10.46

and 12.48, respectively.

QUESTION ID:23

Protein X is an all helical protein with 100 amino acids including 2 cysteines and a pI of 7.0. Which one of the following graphs best describes the solubility of this protein under different ammonium sulphate (salt) concentrations?

QUESTION ID:24

A. 5'‐ AGTAGTATCAACTATCATGA‐3'

     3'‐ TCATCATAGTTGATAGTACT‐5'

B.  5'‐ GACGTGCCAGGTGCGAGGTC‐3'

      3'‐ CTGCACGGTCCACGCTCCAG‐5'

C.  5'‐ TACGATGCACATGCTTGGAC‐3'

      3'‐ ATGCTACGTGTACGAACCTG‐5'

D.  5'‐ GAACGCTACGTTGCGATCCG‐3'

   3'‐ CTTGCGATGCAACGCTAGGC‐5' 

Arrange the DNA fragments (A to D) in the order of decreasing melting temperature. 

QUESTION ID:25

Which one of the following statements about Short Interspersed Nuclear Elements (SINEs) is TRUE?

QUESTION ID:26

Membrane‐enclosed organelles often have a characteristic position in the cytosol. In animal cells, for example, the Golgi apparatus is located close to the nucleus. Which component is directly involved in ensuring correct Golgi localization in animal cells?

QUESTION ID:27

Signal sequences direct proteins to the correct intracellular locations. Which one of the following sequences is typically used to import proteins into the nucleus?

QUESTION ID:28

Which one of the following statements about stem cells is correct?

QUESTION ID:29

Heating of some nucleic acids shows an increase in the absorbance at 260 nm (A260) typified by the plot shown above. The sharp transition midpoint is defined as melting temperature (Tm). Which one of the following nucleic acid samples is NOT expected to generate such a typical profile upon heating of its solution?

QUESTION ID:30

A mutation in which one of the following sigma factors may be a possible cause for E. coli failing to adapt in response to thermal stress?

QUESTION ID:31

Which one of the following statements about Cre‐mediated site‐specific recombination at loxP sites is INCORRECT?

QUESTION ID:32

Given below are a set of enzymes in Column A and enzyme activities in Column B. 

Choose the option that matches the contents of column A with that of column B 

QUESTION ID:33

If TLR2 is knocked out from human monocyte‐derived macrophages, PAMP recognition by which one of the following TLRs will most probably get affected?

QUESTION ID:34

With reference to the signaling pathway shown above, which one of the following options correctly identifies the intracellular components?

QUESTION ID:35

Nitric oxide (NO) acts as intracellular second messenger by stimulating

QUESTION ID:36

Which one of the following pathogens does not have the ability to survive within macrophages?

QUESTION ID:37

The embryonic stem cells in mammals are derived from:

QUESTION ID:38

Which one of the following transcription factors is important for delimiting the meristematic and elongation zones of roots?

QUESTION ID:39

Movement of epithelial sheet spreading as a unit to enclose deeper layers of the embryo is termed as

QUESTION ID:40

β‐thioglucosidases, also known as myrosinases, are the enzymes that are known to hydrolyse which one of the following plant natural products?

QUESTION ID:41

The high affinity ammonium uptake system in plant’s roots involves transporters in the AMT/Rh family. Which of the following AMT genes is expressed in cortex and endodermis?

QUESTION ID:42

Which one of the following are the correct encoding sites of large and small subunits of  Rubisco enzyme in red and brown algae?

QUESTION ID:43

Which one of the following correctly states the action of sucrose phosphate synthase enzyme?

QUESTION ID:44

The time taken by synaptic vesicles to travel from the soma of a motor neuron in the spinal cord to its neuromuscular junction in a person’s foot by fast axon transport is about‐

QUESTION ID:45

The release of which neurotransmitter from the rods of retina is reduced when light strikes its outer segment?

QUESTION ID:46

The principal product of fat digestion by pancreatic lipase is the free fatty acids (FFAs) and which one of the following?

QUESTION ID:47

Which one of the following tissues normally DOES NOT produce ghrelin that stimulates food intake?

QUESTION ID:48

A newborn baby got mixed up with other babies in a hospital. If the mother is of O blood group and is Rh +ve and the father is of AB blood group and is Rh ‐ve, which one of the following can be their baby?

QUESTION ID:49

Two genes a and b are located at a distance of 10cM. Individuals of the genotype AaBb are sib‐mated. The two genes are linked in trans. What percentage of the progeny is expected to have the genotype aabb ?

QUESTION ID:50

Which one of the following statements is true regarding heritability of a quantitative character?

QUESTION ID:51

Chromosomal inversions are balanced rearrangements and thus do not change the overall amount of genetic material. While inversions can exist in homozygous condition, some only exist as heterozygotes. In the latter condition, the breakpoint disrupts:

QUESTION ID:52

Select the correct combination of factors which drive the extinction vortex

QUESTION ID:53

The fall armyworm is a recent, fast invading, destructive herbivore in agricultural systems in north India. This pest species belongs to which one of the following Orders?

QUESTION ID:54

Which one of the following ecosystems is unique to India?

QUESTION ID:55

Recently, the Bhaironghati area of Uttarkashi has been declared a conservation centre for a species referred to as the ‘Ghost of the Mountains’. Which one of the following animals does this refer to?

QUESTION ID:56

Which of the following constitute the largest reservoir of carbon in the global carbon cycle?

QUESTION ID:57

Select the correct statement from the options given below to complete the following. In the 1960s, experiments were conducted to test the theory of island biogeography. The main findings of these studies indicate that over a long period of time____________

QUESTION ID:58

The Covid‐19 pandemic had a major impact on CO emissions due to the disruption of industrial activities caused by it. Which of the following countries/regions had the smallest fall of CO emissions in % terms during the year 2020?

QUESTION ID:59

Select the correct statement that best describes animal territories

QUESTION ID:60

Convergent evolution creates

QUESTION ID:61

Select the correct option that describes the above graph regarding length of bird’s bill:

QUESTION ID:62

Eusocial societies are NOT characterised by which of the following?

QUESTION ID:63

Which one of the following is the most sensitive immunoassay

QUESTION ID:64

What is the nature of India's indigenous COVID‐19 vaccine?

QUESTION ID:65

Which one of the following statements related to genetic transformation of plants is correct?

QUESTION ID:66

Which of the following components is typically NOT utilized while capturing images using a confocal laser scanning microscope (CLSM)?

QUESTION ID:67

The electrodes (also called leads) used for human electroencephalography in a 10‐20 lead system are labeled with an uppercase letter and a subscript number or a letter. Which one of the following is INCORRECT meaning of the labels of electrodes?

QUESTION ID:68

Which one of the following techniques CANNOT be used for separation, detection or visualization of DNA?

QUESTION ID:69

The units of molar extinction coefficient are

QUESTION ID:70

What would be the effect of retinoic acid (RA) treatment on the ‘positional information’ of blastema cells present on the amputated newt limb?

QUESTION ID:71

Two experiments were performed on a peptide sample ‘X’. In experiment 1, treatment of ‘X’ with dithiothreitol (DTT), followed by blocking of free sulphydryl groups, yielded two polypeptides whose amino acid sequences are as shown below:

I. Ala‐Phe‐CysA ‐Met‐Tyr‐CysA ‐Leu‐Trp‐CysA ‐Asn

II. Val‐CysB ‐Trp‐Val‐Ile‐Phe‐Gly‐CysB ‐Lys

In experiment 2, ‘X’ was treated with chymotrypsin, a protease that cleaves the carboxy‐terminal of aromatic residues. The amino acid composition of five peptides obtained from this experiment are shown below

I. ([Ala], [Phe])

II. ([Asn], 2[Cys], [Met], [Tyr])

III. ([Cys], [Gly], [Lys])

IV. (2[Cys], [Leu], 2[Trp], [Val])

V. ([Ile], [Phe], [Val])

Based on the above results, which cysteine/s are linked by disulfide bond in peptide ‘X’?

QUESTION ID:72

The Ramachandran plot graphically shows which combination of torsional angles phi (φ) and psi (ψ) of amino acid residues contained in a peptide are possible. Examination of the plot below shows that only certain regions of the conformational space are permissible.

Why are all the theoretical combinations of φ and ψ not possible?

QUESTION ID:73

Consider the following statements:

B. Pyridoxal phosphate is a co‐factor used by many amino‐ transferases.

C. The affinity of biotin for avidin is one of the highest binding affinities known in biochemistry

D. Enzymes catalyse biochemical reactions by lowering the energy of the transition state

Which one of the following options represents all correct statements?

QUESTION ID:74

The pKa of the ionizable groups in the tripeptide shown below are indicated in the structure.

The isoelectric point (pI) of this peptide is

QUESTION ID:75

What is the fold difference between v at [S] =K and v at [S] = 1000K where v is the initial velocity of an enzyme catalyzed reaction, [S] is substrate concentration and K is the Michaelis constant?

QUESTION ID:76

Purine and pyrimidine nucleotides serve as monomeric units of the nucleic acid polymers DNA and RNA. Mentioned below are some of the statements with respect to the de novo synthesis of nucleotides.

Which one of the following statements is INCORRECT?

QUESTION ID:77

Following statements were made about stress response in prokaryotes:

A. PerR functions as a major peroxide sensor in many Gram‐ positive bacteria.

B. Extreme acidic pH induces RecA‐mediated DNA damage, which in turn may induce virulence gene expression in some pathogenic bacteria.

C. Induced expression of heat shock proteins neither protects the cells from heat nor plays a role in bacterial virulence.

D. In Gram‐negative bacteria, heat shock factor regulates the transcription of the major heat shock proteins.

E. GroES is an ATP‐dependent chaperonin but GroEL may function in ATP‐independent manner.

Which one of the following represents the correct combination of above statements?

QUESTION ID:78

Sequencing of the human genome has identified 67 putative gene encoding K+ channels. To characterize the function of one of these genes, a researcher would typically carry out the following experiments:

A. in vitro transcription of the cloned cDNA for this gene in a cell‐free system to produce the corresponding mRNA

B. Injecting above mentioned mRNA into frog oocytes

C. Measuring channel‐protein activity using a patch‐clamping technique

D. Knocking out the gene encoding the homolog of this channel in frog oocytes and measuring channel activity using a patch‐clamping technique

Choose the correct combination of experiments that would help in the characterization of the K+ channel.

QUESTION ID:79

Cyanide, a chemical warfare agent, is toxic because it:

A. binds to the heme a3 in mitochondrial cytochrome c oxidase (in complex IV)

B. inhibits electron transport and thus oxidative phosphorylation

C. directly blocks mitochondrial DNA replication

D. blocks the protein trafficking inside the mitochondria by affecting TIM and TOM channels

Choose the combination with all correct statements.

QUESTION ID:80

Following statements were made about transposons:

A. Transposons have inverted terminal repeats and their integration generates inverted repeats at the flanks of the target site in the host genome.

B. A composite transposon can transpose as a unit.

C. The transposition event may cause deletions or inversions or move a host sequence to a new location.

D. The transposition event may cause deletions or inversions but cannot move a host sequence to a new location.

E. Replicative transposition proceeds through cointegration.

Which one of the following represents the combination of the correct statements?

QUESTION ID:81

Following statements were made about cell cycle regulation:

A. De novo synthesis and destruction of Cyclin B are essential for cell cycle progression in yeast.

B. De novo synthesis and destruction of Cyclin B and the related Cyclin dependent Kinase (CDK) are essential for cell cycle progression.

C. CDK activity is regulated by both activating and inhibitory phosphorylation.

D. Retinoblastoma (Rb) functions as an inhibitor of G2 to M transition.

E. Inactivation of Sic 1 is essential for transition into S phase.

Which one of the following represents the combination of the correct statements?

QUESTION ID:82

Following statements were made about protein trafficking in cells:

A. Cargo selection occurs when coat proteins bind to the sorting signals either directly or indirectly via adaptor complexes.

B. Protein export from the ER is exclusively mediated through the COPII‐coated vesicles.

C. Identical coat protein is used in the exocytic pathway and/or endocytic pathway.

D. Tethering of the vesicles involves small guanosine triphosphatases (GTPases) of the Rab family.

E. Clathrin‐coated vesicles transport proteins from the plasma membrane to the trans‐Golgi network to late endosomes.

Which one of the following represents the correct combination of above statements?

QUESTION ID:83

The following statements are made with reference to the structure of the nucleosome: A. The histone tetramer in the core of the nucleosome comprises H2A, H2B, H3 and H4. B. The N‐terminal tails of the core histones are believed to stabilize the 30 nm fiber of nucleosomal DNA by their interactions with adjacent nucleosomes. C. The post‐translational modifications of the N‐terminal tails as well as globular domains of the core histones modulate transcriptional events D. According to the zigzag model of the 30 nm fiber the linker DNA circles around the central axis of the fiber as the DNA moves from one nucleosome to the next.

The following statements are made with reference to the structure of the nucleosome:

A. The histone tetramer in the core of the nucleosome comprises H2A, H2B, H3 and H4.

B. The N‐terminal tails of the core histones are believed to stabilize the 30 nm fiber of nucleosomal DNA by their interactions with adjacent nucleosomes.

C. The post‐translational modifications of the N‐terminal tails as well as globular domains of the core histones modulate transcriptional events

D. According to the zigzag model of the 30 nm fiber the linker DNA circles around the central axis of the fiber as the DNA moves from one nucleosome to the next.

Which of the following combinations represents all correct statements?

QUESTION ID:84

The following observations are being made in the context of the regulation of iron homeostasis in mammalian cells.

A. The levels of transferrin receptor mRNA increase 30‐fold in the absence of iron

B. Certain mutations in the 3’UTR of transferrin receptor mRNA fail to support increase in mRNA levels under low iron concentrations

C. The level of transferrin receptor mRNA continues to be high in low iron concentration even when the cells are treated with α‐amanitin

D. The transferrin receptor mRNA levels decrease rapidly when iron is added to the cells.

Based on these observations, which one of the following statements represents the most likely scenario?

QUESTION ID:85

A heterozygote of E. coli was produced with the following combination of mutations:

trpR trpO trpE /trpR trpO trpE

where R is the repressor, O is the operator and trpE encodes the first enzyme in the biosynthetic cascade for tryptophan. Assume all other enzymes required are wild type.

Which one of the following is the most likely phenotype of this E. coli ?

QUESTION ID:86

Precise recognition of tRNAs by their cognate aminoacyl‐tRNA synthetases is crucial for the fidelity of protein synthesis. In the context of the aminoacylation of tRNA with its cognate aminoacyl‐tRNA synthetase (AlaRS) and based on the studies on the molecules of Escherichia coli origin, following statements are made.

Which one of the statements is INCORRECT?

QUESTION ID:87

In the figure above, replication of DNA beginning from the origin of replication of the chromosome of a newly identified bacterium having a double stranded circular DNA genome is shown. Characterization of DNA polymerase responsible for genome replication showed that DNA synthesis occurred in 5’ to 3’ direction and it depends on the presence of a primer (as is the case in Escherichia coli). Polarities of DNA (5’ or 3’) are as shown. Replication begins at a point marked ‘o’ on the left of the bubble, and both the parent strands were replicated concurrently. The longer arrow inside the bubble shows the leading strand, whereas the shorter arrows (marked a, b, c) show the Okazaki fragments. The model depicts a:

QUESTION ID:88

Which one of the following statements is NOT a correct feature of Escherichia coli RNA polymerase?

QUESTION ID:89

Bone marrow cells were sorted using 4 cell‐surface markers, CD45R (B220), CD43 (leukosialin), membrane‐associated Immunoglobulin M (mIgM) and membrane‐associated Immunoglobulin D (mIgD). The sorted cells were then analyzed for immunoglobulin (Ig) gene rearrangements for the heavy chain. With this information, the sorted cells were categorized into different stages of B‐cell development. The observations and the inferences drawn are given below.

Which of the above inferences are correct?

QUESTION ID:90

Virus infected cells are cleared by cytolysis by natural killer (NK) cells and CD8+ Cytotoxic T lymphocytes (CTLs). Which of the following graphs correctly represents the changes in the cell numbers of the two cell types during the course of a viral infection, considering that the virus is cleared by 14 day?

QUESTION ID:91

The gradient of oxygen available to cells at inner regions of a tumour tissue environment is typically low that creates a hypoxic micro‐environment. If enough oxygen is supplied to the cancer cells residing in hypoxic micro‐environment, which one of the following processes may NOT occur?

QUESTION ID:92

Column “X” represents a list of different viruses and column “Y” represents the mechanisms generally adopted by viruses to evade host defense. 

Identify the correct match.

QUESTION ID:93

Although a majority of G protein‐coupled receptors (GPCRs) act through adenylyl cyclase, many of them (GPCR) exert their effects by activating the plasma membrane‐bound enzyme phospholipase C‐β (PLC‐β). These receptors activate the so‐called inositol phospholipid signaling pathway mainly via a G protein called G , which activates PLC‐β in much the same way that Gs activates adenylyl cyclase. Mentioned below are some of the steps with functional characteristics of inositol phospholipid signaling pathway, one of which is not correct. Select the INCORRECT option.

QUESTION ID:94

In an experiment, activin‐secreting beads were placed on unspecified cells from an early Xenopus embryo. The activin then diffused from the beads. If the beads contained 1nM of activin, it elicited expression of Xbra gene in cells near to the beads. If the beads contained 4 nM activin, the expression of Xbra was elicited in cells, but only at a distance of several cell diameters away from the beads. In the latter case, expression of goosecoid gene was observed near the source bead. Beads with no activin did not elicit the expression of the two genes.

Following statements were made regarding the observations and the role of activin in determining cell fate.

A. High concentration of activin activates goosecoid, whereas lower concentrations activate Xbra.

B. Lower concentrations of activin help specify the dorsal‐most structures of the frog’s embryo

C. Concentrations of activin that do not lead to expression of the two genes specifies the cell to become blood vessels and heart

Which of the above statement(s) are correct?

QUESTION ID:95

The specification of sea urchin micromeres involves the activation of a repressor protein Pmar1, which represses the expression of hesC, which also encodes a repressor protein. One of the genes controlled by HesC is Delta, whose expression is used as a marker for micromere lineage. The image below represents a sea urchin embryo on which whole mount in situ hybridization (WMISH) was performed using delta probe, indicated by the area ‘A’. The rest of the embryo is labeled ‘B’.

The table below summarizes a set of experiments (column A) and the area in which hybridization is observed (column B)

Which one of the following options is a correct match between columns A and B?

QUESTION ID:96

Induction is an extrinsic process that depends on the position of a cell in the embryo. It is a process whereby one cell or group of cells can influence the developmental fate of another, and is a common strategy to control differentiation and pattern formation in development. The following statements were made regarding induction in a developing embryo.

A. The inductive signal can be a protein secreted from the inducing cells that binds to receptors of a responding cell.

B. Response to inductive signals depends on competence of the inducing cell.

C. Instructive induction occurs when the responding cell is already committed to a certain fate.

D. Lateral inhibition is an induction that results in differentiation of individual cells in a regularly spaced pattern.

Which one of the following combination of statements is correct?

QUESTION ID:97

The early embryonic development in amphibians and aves serve as two different model plans of development. In the former the germ layer formation is initiated from a fluid‐filled ball like blastula, while in the latter the germ layer formation is initiated on a flat blastodisc. Given below are some of the terms for amphibian embryo in column I and from avian embryo in column II:

Which of the following is the all correct match of the terms in column I with that of column II?

QUESTION ID:98

Following are certain statements related to seed maturation:

A. Seed maturation involves mainly the accumulation of storage products, such as starch, lipids and proteins.

B. A large number of chaperones including the family of LATE EMBRYO ABUNDANT (LEA) proteins, play a crucial role in the dessication process of seeds C. Moisture content gets reduced with the maturation of seed

D. ABA and gibberellin both promote seed dormancy

Which one of the following options has all correct statements?

QUESTION ID:99

Given below are statements related to expression of some of the pattern‐forming genes in vertebrate limb bud:

A. Lmx1b gene is expressed in dorsal mesenchyme

B. Shh is expressed in the posterior region.

C. Wnt7a gene is expressed in dorsal ectoderm.

D. Hoxa13 and Hoxd13 are expressed in the distal region.

E. Tbx5 and FGF10 are expressed in the lateral plate mesoderm involved in formation of limb bud.

The Nail‐Patella syndrome in human and the syndrome in mouse exhibiting footpads on both dorsal and ventral surfaces of limb are associated with which of the above mentioned gene functions? 

QUESTION ID:100

The following statements refer to photosystem structure and function involved in light‐dependent reaction of photosynthesis:

A. The antenna or light harvesting complex absorbs light energy and transfers it to the reaction centre.

B. The first electron is released from P680 and transferred to QA to produce a semiquinone

C. D1, a protein subunit of the plant PS core complex is encoded by gene psbD

Which one of the following combinations of above statements is INCORRECT?

QUESTION ID:101

Following are certain statements regarding photorespiration pathway in plants:

A. The first two‐carbon (2C) compound synthesized by the action of Rubisco in the chloroplast is glycolate.

B. Glycolate exits the chloroplast and enters peroxisomes.

C. Glycolate that is synthesized during C cycle enters the chloroplast from mitochondria.

D. Glycine is transported from peroxisomes to mitochondria.

Which one of the following combinations is INCORRECT? 

QUESTION ID:102

Plant pathogens produce effector molecules that aid in colonization of their host cells. Column X denotes the name of effector molecules and Column Y denotes the potential functions:

QUESTION ID:103

Following statements are made about nitrate transporters in plant cells: A. Nitrate uptake displays two saturable phases, with K in the micromolar (µM) range for the high‐affinity system and in the millimolar (mM) range for the low‐affinity system.

B. The Arabidopsis AtNRT1⋅1 is a dual affinity nitrate transporter.

C. AtNRT 1⋅2 participates in high‐affinity uptake.

D. AtNRT 2⋅1 and AtNRT 2⋅2 are involved in low‐affinity uptake.

Select the option that has the combination of all correct statements.

QUESTION ID:104

Glycophytes are salt‐sensitive plants while halophytes are salt‐tolerant plants. The following statements were made to explain the difference between the glycophytes and halophytes.

A. Glycophytes enhance the uptake of ions.

B. Glycophytes actively pump ions back into the soil.

C. Halophytes have ability to resist net ion uptake in the shoot.

D. Halophytes have greater capacity for vacuolar sequestration of ions.

Select the option that has the combination of all correct statements

QUESTION ID:105

Human chorionic gonadotropin (hCG) is a placental gonadotropin that controls hormonal secretions from corpus luteum during initial stage of pregnancy. Following statements are made about hCG:

A. It is a glycoprotein that contains galactose and hexosamine.

B. It is a heterodimer with a larger alpha subunit and smaller beta subunit.

C. It is a heterodimer with a smaller alpha subunit and larger beta subunit.

D. hCG is identical to beta subunit of LH and FSH.

E. It appears as early as 6 days after conception in blood and 14 days after conception in urine.

Which one of the following has all correct combination of statements?

QUESTION ID:106

The amount of hemoglobin in blood is one of the important health markers. Following statements are made regarding hemoglobin degradation when older red blood cells (RBCs) are destroyed by tissue macrophages.

A. The globin protein of the hemoglobin is split off and heme is converted first to bilirubin by the action of heme oxygenase.

B. The globin protein of the hemoglobin is split off and heme is converted first to biliverdin by the action of heme oxygenase.

C. Carbon monoxide (CO) is formed in the process.

D. Nitric oxide (NO) is formed in the process.

Which one of the following represents correct combination of statements?

QUESTION ID:107

Catecholamines (i.e. dopamine, norepinephrine and epinephrine) are important adrenal medullary hormones which play a role in the response for emergency situations. The following statements are made with reference to this:

B. Dopa decarboxylase (DD) is a soluble enzyme that converts L‐ dopa to dopamine.

C. Dopamine β‐ hydroxylase (DBH) is a particulate enzyme carrying copper in its active site and it converts dopamine to epinephrine.

D. Phenylethanolamine‐N‐methyltransferase (PNMT) is a soluble enzyme that is induced by glucocorticoids.

Which one of the following has the correct combination of statements?

QUESTION ID:108

The following statements were proposed by a researcher on the characteristic features of stretch receptors in atria and the effect of these receptors’ activity on blood pressure regulation:

A. The activity of type A receptors are increased by burst of impulses during atrial systole

B. The activity of type B receptors are increased by burst of impulses at the time of peak atrial filling during late diastole of atria

C. The discharge of type B atrial receptors is increased when venous return is increased

D. The activity of type B atrial receptors is increased by positive pressure breathing

E. The increased activity of most of the atrial receptors initiates reflex circulatory adjustment by increasing blood pressure

F. The heart rate is decreased reflexly by the increased activity of atrial receptors

QUESTION ID:109

The explanations for increased conduction velocity of action potentials in a myelinated nerve fibre (MNF) as compared to that of a non‐myelinated fibre (NNF) of same diameter are suggested below:

A. Much higher number of ions traverse a unit length of an MNF membrane compared to that of an NNF during conduction of action potential as the ionic currents are restricted to the membrane at the Nodes of Ranvier

B. The energy expenditure required to maintain ionic gradient after conduction of action potential in an MNF is higher than that of an NNF

C. The action potentials of MNF do not have a hyperpolarizing effect like that of an NNF

D. The relative refractory period is not extended in an MNF like that of an NNF

E. The axolemma at the nodes of Ranvier lacks K ion channels

F. MNFs are metabolically less efficient than NNFs

QUESTION ID:110

The mechanisms of regulation of H secretion by kidneys in acidosis have been suggested in the following statements: A. Acidosis inhibits the secretion of cortisol by adrenal cortex B. The transcription of Na ‐ H antiporter gene is decreased by cortisol C. The translation of mRNA of 1Na ‐ 3HCO symporter gene is decreased by cortisol D. The secretion of endothelin‐1(ET‐1) from the proximal tubule is enhanced in acidosis E. ET‐1 stimulates the phosphorylation and subsequent insertion of the Na ‐ H antiporter into the apical membrane of proximal tubular cells F. The insertion of 1Na ‐ 3HCO symporter into the basolateral membrane of proximal tubular cells is also increased by ET‐1

The mechanisms of regulation of H secretion by kidneys in acidosis have been suggested in the following statements:

A. Acidosis inhibits the secretion of cortisol by adrenal cortex

B. The transcription of Na ‐ H antiporter gene is decreased by cortisol

C. The translation of mRNA of 1Na ‐ 3HCO symporter gene is decreased by cortisol

D. The secretion of endothelin‐1(ET‐1) from the proximal tubule is enhanced in acidosis

E. ET‐1 stimulates the phosphorylation and subsequent insertion of the Na ‐ H antiporter into the apical membrane of proximal tubular cells

F. The insertion of 1Na ‐ 3HCO symporter into the basolateral membrane of proximal tubular cells is also increased by ET‐1

Choose all CORRECT statements from the following options:

QUESTION ID:111

A Drosophila male carrying an X‐linked temperature sensitive recessive mutation that is lethal at 29°C but viable at 18°C is mated to:

A. a normal female

B. a female containing attached X‐chromosome

If the eggs laid in both the cases are reared at 29°C, what will be male‐female ratio in the given progeny?

QUESTION ID:112

Sampling of 200 persons for their ABO blood group was done from an urban area. The types of blood group observed in the given population are as follows:

A = 60, B = 32, AB = 10 and O = 98

Which of the following gives the correct frequency of blood group determining alleles IA, IB  and IO  in the given population?

QUESTION ID:113

The following figure represents a physical map and a genetic map for 5 different genes (a to e)

Which of the following statements based on the above is correct ?

QUESTION ID:114

In 1990, Bhattacharya et al identified that the wrinkled seed character of pea as described by Mendel is caused by a transposon – like insertion in a gene encoding Starch Branching Enzyme (encoded by the R allele). This leads to an RFLP pattern, when genomic DNA of round and wrinkled seed is digested with EcoRI and probed with the cDNA of the R gene product. The following is a representation of the hybridization pattern.

Based on the above, which one of the following statements is INCORRECT

QUESTION ID:115

A cross is made between Drosophila stocks, each with an independent mutant allele, resulting in white eye color. The mutant alleles (named w and w ) are recessive, X‐linked and caused by a deletion in the w allele. The wild type phenotype is red eye color.

The F1 females are then crossed with wild type males. In the progeny, all females have red eye color, 1 out of 10,000 males was observed to have red eye color, while the remaining had white eyes.

Which one of the following could possibly explain the occurrence of red eyed males in the progeny?

QUESTION ID:116

Doubled haploids (DH) are plants derived from single immature pollen and doubled artificially to form diploids. A DH population was created from F progeny derived from a cross between two parents (P1 and P2), one resistant (R) and the other sensitive (S) to white rust. The parents, F and DH population were profiled with a set of co‐dominant markers, which is represented below.

The following table summarizes the proposed percentage of the 4 different types (1 to 4) of DH progeny, assuming that the DNA marker is (i) unlinked to the gene governing the trait and (ii) linked at a distance of 10cM. 

Which one of the following options correctly represents the expected ratio for unlinked and linked, respectively?

QUESTION ID:117

Consider the following statements about thermoregulation in animals.

A. It uses external environment to regulate internal body temperature

B. It does not use external environment to regulate internal body temperature

C. It can vary internal temperature considerably

D. It can maintain thermal homeostasis in a narrow range of temperatures

Which one of the following options correctly describes a poikilothermic ectotherm?

QUESTION ID:118

Match the organisms in column A with their status in Column B. 

QUESTION ID:119

Select the correct combination of species (column X) and the known cause of their population declines

QUESTION ID:120

According to the APG‐IV (Angiosperm phylogeny group‐IV) which of the following groups of angiosperms first diverged from the common ancestor of the angiosperms?

QUESTION ID:121

The table below enlists name of scientists and different areas of scientific contribution

Which one of the following options represents a correct match between the scientist and the area of his/her scientific contribution?

QUESTION ID:122

The table below lists the name of organisms and different aspects of nervous system.

Which one of the following options represents a correct match between the two columns?

QUESTION ID:123

The microclimate at the ground level is very important to plant life. Each curve (A‐D) in the diagram below shows the temperature profiles collected above and below the bare ground (non‐vegetated) shown with respect to the distance from the ground level (at different times over a 24‐hour period). 

Consider the following four different time points within a diel period (i‐iv). i. Immediately after sunrise ii. Noon iii. Immediately before sunset iv. Midnight. Match the temperature profiles with the correct diel period

QUESTION ID:124

The largest reservoir of nitrogen in the global nitrogen cycle is the atmosphere. Options A‐D below represent important pathways in the removal of nitrogen from the atmosphere at different rates.

A. Biological fixation in oceans

B. Fixation by lightning

C. Biological fixation in natural terrestrial systems

D. Industrial nitrogen fixation

Arrange the above pathways from the lowest to the highest rate.

QUESTION ID:125

Fragmentation breaks up contiguous tracts of natural habitats into smaller patches. In a fragmented landscape where a previously large forest has become a mosaic of patches of different sizes, the following statements can be made about the fragment size and its species diversity.

A. Smaller fragments will always have lower species richness than larger fragments

B. Species richness will depend on fragment size.

C. Species richness will depend on physical connectivity between fragments

D. Species richness cannot be compared between large and small fragments

Select the option where both the statements are correct

QUESTION ID:126

In a high‐altitude meadow region, it was observed that over the last five years 20 forb species flowered 2‐3 weeks earlier than their long‐term average time of flowering. At the same time, their fruit production has fallen.

The following statements were proposed as reasonable explanations for why this is happening:

A. The forbs are responding to a warming climate but pollinators are not available at the same time

B. Early flowering has increased competition for pollinators

C. Flowering and fruiting success are unrelated phenomena in forbs

D. Animals that eat fruits are not available at the right time so fruiting has stopped

Which one of the following options represents statements with correct reasonable explanations?

QUESTION ID:127

Consider predators with a choice between two prey types: a big prey 1 which has energy value E1, handling time h1, and search time S1 and; a small prey 2 with energy value E2, handling time h2, and search time S2. According to the optimal foraging (diet) theory, when will the predator preferentially select prey 2?

QUESTION ID:128

Which of the following is NOT the function of dispersal behaviour in which organisms move away from their natal homes?

QUESTION ID:129

Colour blindness affects approximately 1 in 12 men (8%). In a population that is in Hardy‐Weinberg Equilibrium (HWE) where 8% of men are colour‐blind due to a sex‐linked recessive gene. What proportion of women are expected to be carriers?

QUESTION ID:130

Which of the following pairs of traits is most likely in a species when maternal investment is very high?

QUESTION ID:131

A researcher studying a cricket species finds that individuals on either side of a large river have different call frequencies on average. The following statements were made:

A. The different call frequencies may signal incipient speciation

B. The change in call frequency can lead to allopatric speciation

C. Individuals of one population transplanted to the other population (across the river) may have lower chance of finding mates than residents

D. Call frequencies have changed from ultrasound to infrasound across the river

If the call helps attract mates which of the above statements are correct?

QUESTION ID:132

Biased gene conversion (BGC) has been proposed to cause changes in allele frequencies in a population. Select the statement that is NOT correct about BGC.

QUESTION ID:133

The following statements were made describing the properties of a UPGMA tree (Unweighted Pair Group Method with Arithmetic Mean):

A. It describes species relationships and is therefore the best method to describe a new species.

B. It is a method of hierarchical clustering.

C. The raw data is a similarity matrix and the initial tree is rooted.

D. It permits lineages with largely different branch lengths and corrections for multiple substitutions.

Which one of the following options represents the correct properties?

QUESTION ID:134

When species express a suite of correlated traits (e.g., behavior, morphology, function), within a given context or across contexts, it is referred to a

QUESTION ID:135

Select the option that represents the correct combination of non‐parametric tests and its equivalent parametric test respectively that can be used to compare two or more groups.

QUESTION ID:136

A researcher raised antibodies against sheep red blood cells (SRBCs) and purified the IgG fraction. Some of the IgG antibodies were then subjected to enzymatic digestion to have Fab, Fc and F(ab’) fractions. He placed each preparation in a separate tube ( 1 to 3), labeled the three tubes to indicate their contents, and incubated them on ice. After a while he noticed that the label on two of the tubes (1 and 2) had gotten erased. He did a test for tube 1 and found that the preparation in the tube agglutinated SRBCs but did not lyse them in presence of complement. Which preparation was in tube 1?

QUESTION ID:137

In a forward genetic screen to investigate the heat stress response in Arabidopsis, a team of researchers identified an uncharacterized gene 'x' that shows some sequence homology to alpha‐subunit of heterotrimeric G‐protein. Since a typical alpha‐subunit of heterotrimeric G‐protein localizes at the membrane in a eukaryotic cell, researchers sought to validate whether the protein coded by gene 'x’ localizes to membrane in tobacco protoplasts. To achieve this, they cloned the gene in fusion with GFP at its N‐terminus, under the control of the CaMV promoter; however, upon expression of this GFP‐gene ‘x’ fusion construct, they did not observe any membrane localization of GFP‐signal in tobacco protoplasts. Based on this, they made a few assumptions:

A. N‐terminally tagging of protein ‘X’ with GFP may block membrane localization of protein X

B. Tagging of protein ‘X’ with GFP may alter the conformation of protein X because of its bigger size

C. Tobacco protoplasts are a heterologous system for the expression of gene 'x,' and thus, the protein X does not localize to the membrane

D. Gene 'x' is not getting transcribed because of the wrong promoter choice

QUESTION ID:138

Given below is a figure representing expression levels of transgenic protein in ten independent transgenic plants generated using the same transformation vector by Agrobacterium‐mediated transformation.

 Given below are a few statements to explain the above data:

A. Plant nos. 4, 9 and 10 that show high expression levels of the transgene would necessarily contain multiple copies of the transgene.

B. Plant nos. 2 and 7 contain mutations in the coding sequence of the transgene in the construct.

C. The transgenic plants may contain varying number of transgene copies inserted at different locations in the host genome.

D. The host genome has no role in influencing expression levels of the transgene.

E. The stability of the transgenic mRNA and its translatability would not be different among the independent transgenic plants.

Which one of the following options represents all correct statements?

QUESTION ID:139

In recent decades, the use of genetic markers has allowed the rapid introgression and selection of desired breeding stocks in advance generations. In this regard, following statements are given:

A. AFLP markers can discriminate between homozygote and heterozygote genotypes.

B. Microsatellites (eg. SSR) are capable of detecting higher level of polymorphism than RFLP.

C. SNPs are more prevalent in the coding regions of the genome.

D. SNP markers are the most suitable markers for both foreground and background selection.

QUESTION ID:140

To investigate the relationship between microtubules and centrioles in fixed HeLa cells using an epifluorescence microscope, a researcher plans to conduct immunostaining using antibodies against tubulin and centrin (centriolar protein). After the incubation with the primary antibodies and wash, she/he plans to use secondary antibodies that bind to the primary antibodies. Below is a list of secondary antibodies carrying various fluorophores (dyes) available to the researcher.

A. Alexa 568

B. FITC

C. Alexa 488

D. Alexa 647

QUESTION ID:141

Find the linear regression equation for the following data pairs (x, y) given in the above table

QUESTION ID:142

The Green Fluorescent Protein (GFP) from the deep‐sea jellyfish Aequorea victoria has excitation peaks at 395 nm and 475 nm. Its emission peak is at 509 nm, which is in the green portion of the visible spectrum. In the deep‐sea habitat of this marine organism, what is the source of light for excitation of GFP?

QUESTION ID:143

For the template sequence given below, which one of the following combination of primers can hypothetically be used to amplify the target region (Ignore Tm & length parameters for the primers)? 5'‐ A T C G A C T A G NNNNNNNNNNNNNNNNN C C T A A T G C A G ‐ 3'

QUESTION ID:144

Which one of the following combinations of enzymes used for cloning a linear insert fragment into a digested plasmid vector would have the least probability of generating self‐ligated vectors in a cloning experiment following complete digestion of all vector molecules and no further enzymatic treatment of the vector?