In intestinal lumen epithelial cells, which of the following occurs by passive transport?

a. import of Na+ on the apical side    

b. export of Na+ on the basal side

c. import of glucose on the apical side           

d. export of glucose on the basal side

TLS Online TPP Program

#Question id: 4211

#Unit 3. Fundamental Processes

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 19350

#Unit 12. Applied Biology

An example of promoter that can respond to light could be

1. cab

2. rbcs

3. AdhI

Which of the option contains incorrect example?

TLS Online TPP Program

#Question id: 2731

#Unit 2. Cellular Organization

Which of the following is not a characteristic of the nuclear scaffold?

TLS Online TPP Program

#Question id: 19903

#Unit 12. Applied Biology

The capacitive sensors used to measure __________________ ?

TLS Online TPP Program

#Question id: 18678

#Unit 13. Methods in Biology

which of the following technique can be analysed of PCR products from HIV-I allowed the identification of between 200 000 and 500 000 viral particles per cubic centimetre of serum.