In an individual heterozygous, the abnormal chromosome loops out during chromosome pairing in prophase I, in which condition?

TLS Online TPP Program

#Question id: 13096

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 4068

#Unit 3. Fundamental Processes

The three eukaryotic RNA polymerases can be distinguished by

a. the types of genes they transcribe.

b. the number and types of large subunits.

c. their differential sensitivities to cycloheximide.

d. their differential sensitivities to α-amanitin.

TLS Online TPP Program

#Question id: 133

#Unit 1. Molecules and their Interaction Relevant to Biology

Tyrosine and tryptophan are less hydrophobic than phenylalanine because

TLS Online TPP Program

#Question id: 28881

#Unit 4. Cell Communication and Cell Signaling

Noncanonical pathways consider under various other pathways, except? 

TLS Online TPP Program

#Question id: 3057

#Unit 2. Cellular Organization

Mean generation time of bacteria is 20 min. 6 hours of incubation, the bacterial population increases from 10^3 cells to