How many bonded atoms are required to constitute a dihedral (torsion) angle, such as phi or psi?

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 2564

#Unit 2. Cellular Organization

A cell with a predominance of rough endoplasmic reticulum is most likely ________.

TLS Online TPP Program

#Question id: 31108

#Unit 2. Cellular Organization

Match the following proteins (column A) with their functions (column B) 

TLS Online TPP Program

#Question id: 31335

#Unit 2. Cellular Organization

The following statements are made with reference to  SNARE proteins & membrane fusion reactions in vesicle transport. Which of the following statement is incorrect?

TLS Online TPP Program

#Question id: 14882

#Unit 4. Cell Communication and Cell Signaling

In bone marrow, stem cells are committed to different lineages. Factors that stimulate colonies of these different lineages are interleukin-3 (multi-CSF), IL-7,  granulocyte- macrophage colony stimulating factor (GM-CSF) and granulocyte or macrophage colony- stimulating factor (G-CSF or M-CSF). In a mouse deficient in IL-7 the number of which cells will not be altered