If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Question id: 6564

#General Aptitude

Find the wrong number in the series : 3, 4, 10, 32, 136, 685, 4116

#Question id: 4989

#Unit 11. Evolution and Behavior

If the malesʹ halteres have species-specific size, shape, color, and use in courtship displays, and if the speciesʹ ranges overlap, then the speciation events may have been driven, at least in part, by which of the following?

#Question id: 26574

#Unit 3. Fundamental Processes

Which of the following is incorrect about De novo methylase & Perpetuation methylase

a. De novo methylase recognises unmethylated strand and methylated at single strand 

b. De novo methylase recognises unmethylated strand and methylated at single strand 

c. Perpetuation methylase recognises hemimethylated strand and methylated at both strand 

d. Perpetuation methylase recognises unmethylated strand and methylated at one strand 

#Question id: 1407

#Unit 4. Cell Communication and Cell Signaling

Which of the following is pro-apoptotic?

a. Bax              b. Bcl-2                       c. p53              d. protein kinase B      e. PTEN

#Question id: 4640

#Unit 11. Evolution and Behavior

During drought years on the Galapagos, small, easily eaten seeds become rare, leaving mostly large, hard-cased seeds that only birds with large beaks can eat. If a drought persists for several years, what should one expect to result from natural selection?