TLS Online TPP Program

#Question id: 4211


If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Unit 3. Fundamental Processes
  1. 6

  2. 14

  3. 10

  4. 7

More Questions
TLS Online TPP Program

#Question id: 4500

#Unit 3. Fundamental Processes

The free end of the second RNA is uncapped and thus can be distinguished from genuine transcripts. This new RNA is recognized by an RNase called, in yeast, _ and in humans_ that is loaded onto the end of the RNA by another protein that binds the CTD of RNA polymerase.

TLS Online TPP Program

#Question id: 4501

#Unit 3. Fundamental Processes

According to Models of termination: torpedo and allosteric, which one is now the favored and why;

A. The Rat1 enzyme is very processive and quickly degrades the RNA in a 5’ -to-3’ direction, until it catches up to the still-transcribing polymerase from which the RNA is being spewed.

B. Termination depends on a conformational change in the elongating polymerase that reduces the processivity of the enzyme leading to spontaneous termination soon afterward.

TLS Online TPP Program

#Question id: 4502

#Unit 3. Fundamental Processes

Which one is the only GTF that is used by Pol I and Pol III as well as by Pol II, it has emerged recently that some of the other GTFs

TLS Online TPP Program

#Question id: 4503

#Unit 3. Fundamental Processes

Pol I transcribes the human rRNA genes, the promoter for the rRNA gene comprises two parts: the core element and the UCE (upstream control element), for initiation there are two factors-

TLS Online TPP Program

#Question id: 4504

#Unit 3. Fundamental Processes

What will be the molecular weight of poly(A) chain consisting of 100 residues, where weight of AMP is 500?

TLS Online TPP Program

#Question id: 4505

#Unit 3. Fundamental Processes

Symplekin protein is participats in which of the following processes;