#Question id: 4207
#Unit 3. Fundamental Processes
If there is more globin than heme present in a reticulocyte, globin synthesis is stopped by
#Question id: 4208
#Unit 3. Fundamental Processes
Tryptophan synthesis is controlled by a repressor protein which is activated by a corepressor which is
#Question id: 4209
#Unit 3. Fundamental Processes
Tryptophan synthesis can be controlled by a process called attenuation in which the levels of tryptophan in the cell control translation by
#Question id: 4210
#Unit 3. Fundamental Processes
Which statement is true about the attenuation mechanism of regulation?
#Question id: 4211
#Unit 3. Fundamental Processes
If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode?
5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’
#Question id: 4212
#Unit 3. Fundamental Processes
Which statement describes the correct order of events in translation elongation?
