#Question id: 4211
#Unit 3. Fundamental Processes
If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode?
5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’
#Question id: 4212
#Unit 3. Fundamental Processes
Which statement describes the correct order of events in translation elongation?
#Question id: 4213
#Unit 3. Fundamental Processes
Which statement describes the correct order of events in prokaryotic translation initiation?
#Question id: 4214
#Unit 3. Fundamental Processes
Arrange the events listed below in order according to the signal hypothesis:
I. Signal sequence binds to SRP
II. Translation stops
III. Translation starts
IV. Ribophorins anchor complex
V. SRP dissociates; GTP hydrolyzed
VI. SRP-signal complex binds to docking protein
#Question id: 4215
#Unit 3. Fundamental Processes
When an oligosaccharide is covalently bonded to an asparagine (or other amino acid) side chain, the resulting product is a(n)
#Question id: 4216
#Unit 3. Fundamental Processes
Which of the following processes is the first event to take place in translation in eukaryotes?