If glucose labeled with 14C at C^-1 (the aldehyde carbon) were metabolized in the liver, the first radioactive pyruvate formed would be labeled in:

TLS Online TPP Program

#Question id: 3775

#Unit 3. Fundamental Processes

What are telomeres?

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 8697

#Unit 9. Diversity of Life Forms

Use the figure to answer the following question.

Which extinct species should be the best candidate to serve as the outgroup for the clade whose common ancestor occurs at position 2 in the figure?

TLS Online TPP Program

#Question id: 12166

#Unit 8. Inheritance Biology

If cross has made between the plant height 46cm and 10cm , then the F1 progeny shown 28cm . If the of this cross is 3QTL, then how much phenotypes will be formed?

TLS Online TPP Program

#Question id: 112

#Unit 1. Molecules and their Interaction Relevant to Biology

The major groups of lipids can be separated by silicic acid column chromatography by eluting with