TLS Online TPP Program

#Question id: 28454


A researcher performed an experiment during vulva formation in C.elegans;
I- In first experiment destroyed anchor cell 
II- In second experiment destroyed three central VPCs 
What kind of conclusion has been drawn by these experiments?
a) I-Three cells out of six of the equivalence group divide once and contribute to the vulva formation
b) I-all six cells of the equivalence group divide once and contribute to the hypodermal tissue
c) II-three outer cells, which normally form hypodermis, generate vulval cells instead
d) II-three remaining cells normally formed hypodermis as usually

#Unit 5. Developmental Biology
  1. a and c
  2. b and c
  3. a and d
  4. b and d
More Questions
TLS Online TPP Program

#Question id: 27391

#Unit 1. Molecules and their Interaction Relevant to Biology

Choose the correct statement
1.Transfer of electrons is the characteristic of ionic bond 
2.Sharing of electrons is the characteristic of ionic bond
3.Sharing of electron is the characteristics of covalent bond 
4.Transfer of electron is the characteristics of covalent bond

TLS Online TPP Program

#Question id: 10905

#Unit 6. System Physiology – Plant

The rate of movement of materials in the sieve elements can be expressed in two ways: as velocity, or as mass transfer rate. In early publications reporting on rates of transport in the phloem, what is the velocity and the mass transfer rate?

i) velocity-centimeters per hour (cm h-1) and mass transfer- grams per hour per square centimeter (g h-1 cm-2)

ii) velocity-the linear distance traveled per unit time and mass transfer rate-the quantity of material passing through a given cross section of phloem or sieve elements per unit time.

iii) velocity- the quantity of material passing through a given cross section of phloem or sieve elements per unit time and mass transfer rate- the linear distance traveled per unit time

iv) velocity- per hour per square centimeter (h-1 cm-2) and mass transfer- kg centimeters per hour (cm h-1)

TLS Online TPP Program

#Question id: 2004

#Unit 4. Cell Communication and Cell Signaling

A bone marrow transplant may not be appropriate from a given donor (Jane) to a given recipient (Janeʹs cousin Bob), even though Jane has previously given blood for one of Bobʹs needed transfusions. Which of the following might account for this?

TLS Online TPP Program

#Question id: 19703

#Unit 13. Methods in Biology

What is aVR in augmented unipolar limb lead?

TLS Online TPP Program

#Question id: 13095

#Unit 13. Methods in Biology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.
 

 
 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’
(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’
(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’
Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.