Correct sets of genes are well known to be involved in aging and its prevention, and each set appears to be conserved between phyla and even kingdoms. 

a. DNA repair enzymes

b. proteins of the insulin signaling pathway

c. proteins in the mTORC1 signaling pathway

d. chromatin remodeling enzymes

TLS Online TPP Program

#Question id: 32313

#Unit 2. Cellular Organization

Why does actin subunit addition outpace nucleotide hydrolysis at the plus end but not at the minus end?

TLS Online TPP Program

#Question id: 1148

#Unit 4. Cell Communication and Cell Signaling

Phosphatidylinositol 4,5-bisphosphate (PIP2) is cleaved by phospholipase C into:

TLS Online TPP Program

#Question id: 5160

#General Aptitude

The last digit of the number 3²⁰¹⁵ is

TLS Online TPP Program

#Question id: 27101

#Unit 1. Molecules and their Interaction Relevant to Biology

Choose the incorrect regarding γ-turns

TLS Online TPP Program

#Question id: 4211

#Unit 3. Fundamental Processes

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’