TLS Online TPP Program

#Question id: 698


Amino acid residues commonly found in the middle of B turn are:

#Unit 1. Molecules and their Interaction Relevant to Biology
  1. Ala and Gly.

  2. hydrophobic.

  3. Pro and Gly.

  4. those with ionized R-groups.

More Questions
TLS Online TPP Program

#Question id: 16317

#Unit 7. System Physiology – Animal

Developmental stress:

TLS Online TPP Program

#Question id: 2019

#Unit 4. Cell Communication and Cell Signaling

Which of the following is not a component of an insectʹs defense against infection?

TLS Online TPP Program

#Question id: 13100

#Unit 13. Methods in Biology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 10663

#Unit 10. Ecological Principles

Following is a hypothetical life table of species


Following some statement is given

A- This type of life table is characteristic of species that produce a large number of offspring

B- Its greatest mortality early in life, with relatively low rates of death for those surviving this bottleneck

C. It is characterized by high age-specific survival probability in early and middle life, followed by a rapid decline in survival in later life

D. This includes k selected species

Which of the following above statement is correct?

TLS Online TPP Program

#Question id: 1742

#Unit 4. Cell Communication and Cell Signaling

The T-cell receptor link to MHC–peptide is enhanced by interaction between MHC class II on the antigen-presenting cells with the following molecule on the T-cell: