You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

#Question id: 4826

#Unit 8. Inheritance Biology

In Drosophila melanogaster, vestigial wings are determined by a recessive allele of a gene that is linked to a gene with a recessive allele that determines black body color. T. H. Morgan crossed black-bodied, normal-winged females and gray-bodied, vestigial-winged males. The F1 were all gray bodied, normal winged. The F1 females were crossed to homozygous recessive males to produce testcross progeny. Morgan calculated the map distance to be 17 map units. Which of the following information is correct about the testcross progeny?

#Question id: 4827

#Unit 8. Inheritance Biology

A cross between individuals with genotypes AaBbX aabb produces the following progeny:

AaBb -  83, aaBb- 21, Aabb-   19,  aa bb -77

Which of the following statements is true?

#Question id: 4828

#Unit 8. Inheritance Biology

Consider two pairs of alleles, G/g and H/h, that follow complete dominance inheritance. The initial cross consisted of GG hh males and gg HH females, and the F I female progeny were test crossed with gg hh males to produce 380 Gghh progeny out of 1000 total progeny. What is approximate distance between Gene G and H.

#Question id: 4829

#Unit 8. Inheritance Biology

Plant with genotype AaBb is selfed . the two gene are linked and are 50 map units apart. What proportion of progeny will have the genotype aabb?

#Question id: 4830

#Unit 8. Inheritance Biology

Blue flower is dominant over white flower and long pollen is dominant over short pollen. A pure line plant with Blue flower and long pollen was cross with white flower and short pollen. F1 plant was allowed to test cross to produced numerous Offspring in following number

Blue flower and long pollen            2000

Blue flower and short pollen             500

White flower and long pollen            500    

White flower and short pollen         2000

What is approximate distance between Flower color gene and pollen length gene?

#Question id: 4831

#Unit 8. Inheritance Biology

There are 4 pairs of chromosomes in a Drosophila.The linkage groups present in it are