You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 18597

#Unit 11. Evolution and Behavior

Rapid development of the flowering plant appeared in which geological era?

TLS Online TPP Program

#Question id: 18598

#Unit 11. Evolution and Behavior

First forest plants appeared in which geological period time scale?

TLS Online TPP Program

#Question id: 24519

#Unit 11. Evolution and Behavior

Natural selection idea is developed  independently by

TLS Online TPP Program

#Question id: 24520

#Unit 11. Evolution and Behavior

which of the following characteristics that are involved to enhances the survival and reproduction of organisms that bear it ?

TLS Online TPP Program

#Question id: 24521

#Unit 11. Evolution and Behavior

Adaptation is involved in

a. aestivation

b. Genetic drift

c. Origin of new species

d. Coevolution

TLS Online TPP Program

#Question id: 24522

#Unit 11. Evolution and Behavior

Plants will grow continuously  and refer to  genetically and phenotypically changes in the characteristics of interacting species resulting from the natural selection is applied on insect. This is an example of