You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

  

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two DNA sequences?

#Question id: 12958

#Unit 10. Ecological Principles

The Norway rat (Rattus Norvegicus), a widespread pest, was controlled for about a decade by the anticoagulant warfarin. This chemical substance, placed in food pellets, is absorbed by the intestinal tract and inhibits the clotting of blood. After a population decline for about 10 years, rat populations increased and stabilized. In one European population, as illustrated in the graph below, the percentage of rats resistant to warfarin has remained fairly stable over a number of years

Resistance to warfarin is governed by a dominant autosomal gene, R. More than 15 percent of the resistant animals are heterozygous at this locus (Rr). The table below indicates the response to warfarin and relative reproductive fitness of individuals that are homozygous or heterozygous for the dominant gene (R). The RR individuals have a 20-fold increase in vitamin K requirement over individuals.

Fitness is a measure of the reproductive success of a particular genotype. The highest fitness is 1.00.

The strong dependence of RR individuals on large quantities of vitamin K probably is responsible for

#Question id: 12959

#Unit 10. Ecological Principles

#Question id: 12960

#Unit 10. Ecological Principles

The Norway rat (Rattus Norvegicus), a widespread pest, was controlled for about a decade by the anticoagulant warfarin. This chemical substance, placed in food pellets, is absorbed by the intestinal tract and inhibits the clotting of blood. After a population decline for about 10 years, rat populations increased and stabilized. In one European population, as illustrated in the graph below, the percentage of rats resistant to warfarin has remained fairly stable over a number of years.

Resistance to warfarin is governed by a dominant autosomal gene, R. More than 15 percent of the resistant animals are heterozygous at this locus (Rr). The table below indicates the response to warfarin and relative reproductive fitness of individuals that are homozygous or heterozygous for the dominant gene (R). The RR individuals have a 20-fold increase in vitamin K requirement over individuals.

#Question id: 12961

#Unit 10. Ecological Principles

Refer to the following experiment, which is designed to test the co evolutionary relationships among an unpalatable butterfly (the  monarch),  a  palatable  butterfly  (the  viceroy),  and  a  butterfly  predator  (the  jay).  Monarch butterflies are reared on three diets: milkweed (their natural food), cabbage, and cabbage treated with an extract from milkweed leaves. Viceroy butterflies, mimics of monarchs, also are reared on three diets: willows (their natural food), cabbage, and cabbage treated with an extract from milkweed leaves. In trial 1 of the first experiment, adult butterflies reared on a particular diet are presented one at a  time  at  1-hour  intervals  to  jays  and  the  jays  are  allowed  to  feed.  Each jay is  fed  until  it refuses to eat the butterfly presented, but no more than 12 butterflies are presented to a jay during a particular test. Five birds are used for each test; therefore, up to 60 butterflies can be consumed for each diet test. The observer records the actual number of butterflies  eaten. In trial 2, the experiment is repeated 2 weeks later. In the second experiment, the butterflies are reared on the same diets as in experiment 1. However, when they are offered to jays, some jays receive a monarch  reared  on  milkweed  before  being  offered  the  butterflies  reared  on  the  experimental  diets;  the  other  group  of jays is  first given a viceroy reared on willow before being  offered the butterflies reared on the experimental diets. The initial butterfly offered is included in the total number eaten, but no more than 12 butterflies are presented to each jay.

The data in the table indicate which of the following?

#Question id: 12962

#Unit 10. Ecological Principles

#Question id: 12963

#Unit 10. Ecological Principles