You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

#Question id: 4066

#Unit 3. Fundamental Processes

Specific DNA control elements in promoters can

a. interact with general transcription factors.

b. interact with repressor proteins. 

c. interact with activator proteins.

d. remain unavailable because of condensed chromatin.

#Question id: 4067

#Unit 3. Fundamental Processes

Reporter genes are used to

a. express enzymes that are not easily assayed in cell extracts.

b. express enzymes that are easily assayed in cell extracts.

c. characterize DNA control elements. 

d. characterize reporter plasmids.

#Question id: 4068

#Unit 3. Fundamental Processes

The three eukaryotic RNA polymerases can be distinguished by

a. the types of genes they transcribe.

b. the number and types of large subunits.

c. their differential sensitivities to cycloheximide.

d. their differential sensitivities to α-amanitin.

#Question id: 4069

#Unit 3. Fundamental Processes

Which of the following can be identified using a series of promoter linker scanning mutations?

a. areas of the promoter that are non-essential

b. areas of the promoter that are essential

c. the presence of separate transcriptional control regions

d. spacing constraints on separate transcriptional control regions

#Question id: 4070

#Unit 3. Fundamental Processes

An enhancer

a. can be located upstream of a promoter.

b. can be located downstream of a promoter.

c. can be located a variable distance from the promoter.

d. is always located within 1 kb of the promoter.

e. can be cell-type-specific.

#Question id: 4071

#Unit 3. Fundamental Processes

The fact that a specific protein leaves a “footprint” on a DNA molecule is indicative of

a. a lack of interaction between the specific protein and DNA.

b. protection from DNAse by the specific protein.

c. binding of the specific protein to all types of DNA.

d. binding of the specific protein to a specific sequence of DNA.