Practice Questions

TLS Online TPP Program

#Question id: 13143

The Norway rat (Rattus Norvegicus), a widespread pest, was controlled for about a decade by the anticoagulant warfarin. This chemical substance, placed in food pellets, is absorbed by the intestinal tract and inhibits the clotting of blood. After a population decline for about 10 years, rat populations increased and stabilized. In one European population, as illustrated in the graph below, the percentage of rats resistant to warfarin has remained fairly stable over a number of years.
Resistance to warfarin is governed by a dominant autosomal gene, R. More than 15 percent of the resistant animals are heterozygous at this locus (Rr). The table below indicates the response to warfarin and relative reproductive fitness of individuals that are homozygous or heterozygous for the dominant gene (R). The RR individuals have a 20-fold increase in vitamin K requirement over individuals.
Fitness is a measure of the reproductive success of a particular genotype. The highest fitness is 1.00.
In a population where warfarin is no longer applied, the expectation is that the

#Unit 10. Ecological Principles

Dominant gene (R) will supplant the recessive gene (r) in the population
Heterozygotes (Rr) will have a reproductive advantage over both homozygotes (RR and rr)
Frequency of the dominant gene (R) will decline
Frequency of recessive individuals will gradually decline

More Questions

TLS Online TPP Program

#Question id: 13101

#Unit 13. Methods in Biology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 13102

#Unit 13. Methods in Biology

With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.)

You do each PCR reaction and load each one into a separate well of an agarose gel, and then run the gel.

Why is it that having more repeats leads to a band that is higher in the gel?

TLS Online TPP Program

#Question id: 13103

#Unit 13. Methods in Biology

With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.)

You do each PCR reaction and load each one into a separate well of an agarose gel, and then run the gel.

Why is it that some people show only one band?

TLS Online TPP Program

#Question id: 13104

#Unit 13. Methods in Biology

With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.)

You do each PCR reaction and load each one into a separate well of an agarose gel, and then run the gel.

Why is it that some people show two bands?

TLS Online TPP Program

#Question id: 13105

#Unit 13. Methods in Biology

With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.)

You do each PCR reaction on chromosome 15 and load each one into a separate well of an agarose gel, and then run the gel.

Given the data so far, for which of the following statement is correct

TLS Online TPP Program

#Question id: 13106

#Unit 13. Methods in Biology

With the help of DNA fingerprinting which can be used to determine paternity. There are three babies (Baby A, Baby B and Baby C) in a maternity ward, and three sets of confused and worried parents. (Father and Mother #1 are a couple, as are Father and Mother #2, and Father and Mother #3.)

You do each PCR reaction on chromosome 15 and load each one into a separate well of an agarose gel, and then run the gel.

Why is it that some people only have one band?