TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 18717
#Part-A Aptitude & General Biotechnology
A common method to monitor synthesis of new DNA is
TLS Online TPP Program
#Question id: 18666
#Part-A Aptitude & General Biotechnology
The above figure shows where sample applied was 100 µg of total protein extracted from a normal dog heart ventricle. The first dimension was conducted using a pH 4–7 isoelectric focussing gel. The second dimension was a 12% SDS–PAGE vertical slab gel. The pattern was visualised by silver staining. Which of the following techniques is applied
TLS Online TPP Program
#Question id: 4211
#Part-A Aptitude & General Biotechnology
If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode?
5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’
TLS Online TPP Program
#Question id: 12675
#Part-B Specialized Branches in Biotechnology
Use the incomplete diagram below, illustrating some of the steps involved in eutrophication to answer the following questions
What would be a likely entry for box A?
TLS Online TPP Program
#Question id: 666
#Part-A Aptitude & General Biotechnology
Nearly all peptide bonds are in the trans configuration because