TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 687
#Part-A Aptitude & General Biotechnology
All of the following are considered “weak” interactions in proteins, except:
TLS Online TPP Program
#Question id: 14118
#Part-A Aptitude & General Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 2260
#Part-A Aptitude & General Biotechnology
The term "nuclear envelope" is more correct than the term "nuclear membrane" because
TLS Online TPP Program
#Question id: 16785
#Part-A Aptitude & General Biotechnology
Median of 25, 72, 28165,29, 60, 30, 54132, 53, 33, 52, 35,51, 42, 48145, 47, 46, 33 is
TLS Online TPP Program
#Question id: 826
#Part-B Specialized Branches in Biotechnology
Which one is incorrect about the proteins with segments rich in Pro (P), Glu (E), Ser (S), and Thr (T), the so-called PEST proteins,