TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 14118
#Part-A Aptitude & General Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 362
#Part-A Aptitude & General Biotechnology
A 0.01 M solution of a substance has a pH of 2. What can you conclude about this substance?
TLS Online TPP Program
#Question id: 15418
#Part-B Specialized Branches in Biotechnology
In which type of interaction, the responding tissue has already been specified and needs only an environment that allows the expression of particular traits?
TLS Online TPP Program
#Question id: 19041
#Part-A Aptitude & General Biotechnology
Chromatogram is__________
TLS Online TPP Program
#Question id: 630
#Part-A Aptitude & General Biotechnology
In case of competitive inhibition, plots of Km against [Io] fixed [Eo] have