TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 11451
#Part-A Aptitude & General Biotechnology
Immediately after putting on a shirt, your skin might feel itchy. However, this perception soon fades due to ________.
TLS Online TPP Program
#Question id: 14118
#Part-A Aptitude & General Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 14112
#Part-A Aptitude & General Biotechnology
Proteomics refers to the study of __________.
TLS Online TPP Program
#Question id: 3639
#Part-A Aptitude & General Biotechnology
Replication of a bacterial chromosome normally starts at a fixed point called:
TLS Online TPP Program
#Question id: 8909
#Part-B Specialized Branches in Biotechnology
Which of the following terms or structures is properly associated only with animals?