Depolymerization of microtubules is inhibited by

#Question id: 4204

#Part-A Aptitude & General Biotechnology

For each amino acid added to a polypeptide chain, __ phosphoanhydride bonds are cleaved.

#Question id: 4206

#Part-A Aptitude & General Biotechnology

Ribosomal protein synthesis is controlled by inhibitor proteins, the genes of which are located on the ribosomal protein operon, and which bind to __ when ribosome assembly slows and bind to __ when ribosome assembly is proceeding at a steady rate.

#Question id: 4207

#Part-A Aptitude & General Biotechnology

 If there is more globin than heme present in a reticulocyte, globin synthesis is stopped by

#Question id: 4208

#Part-A Aptitude & General Biotechnology

Tryptophan synthesis is controlled by a repressor protein which is activated by a corepressor which is

#Question id: 4209

#Part-A Aptitude & General Biotechnology

Tryptophan synthesis can be controlled by a process called attenuation in which the levels of tryptophan in the cell control translation by

#Question id: 4211

#Part-A Aptitude & General Biotechnology

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’