Injection of an immature Xenopus oocyte with MPF induces:

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 5256

#Part-A Aptitude & General Biotechnology

If the experimental population of E. coli lacks an F factor or F plasmid, and if bacteriophage are excluded from the bacterial cultures, then which of these is a means by which beneficial mutations might be transmitted horizontally to other E. coli cells?

TLS Online TPP Program

#Question id: 10255

#Part-B Specialized Branches in Biotechnology

In sucrose synthase combines sucrose with UDP to produce fructose and UDP-glucose in the cytosol. What is the function of UDP-glucose pyrophosphorylase?

TLS Online TPP Program

#Question id: 11203

#Part-B Specialized Branches in Biotechnology

Which of the following statements about action potentials is correct?

TLS Online TPP Program

#Question id: 5201

#Part-A Aptitude & General Biotechnology

How is a physical map of the genome of an organism achieved?