Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 22705
TLS Online TPP Program

#Question id: 3867

RNA polymerase from E. coli (core enzyme alone) has all of the following properties except that it:

#Part-A Aptitude & General Biotechnology

  1. can extend an RNA chain and initiate a new chain.

  2. is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.

  3. produces an RNA polymer that begins with a 5'-triphosphate.

  4. recognizes specific start signals in DNA.

More Questions
TLS Online TPP Program

#Question id: 11140

#Part-B Specialized Branches in Biotechnology

Although the membrane of a "resting" neuron is highly permeable to potassium ions, its membrane potential does not exactly match the equilibrium potential for potassium because the neuronal membrane is also ________.
TLS Online TPP Program

#Question id: 19242

#Part-B Specialized Branches in Biotechnology

The GUS activity in transformed plant tissues can be localized by the presence of a blue color that is formed after the hydrolysis of the uncolored substrate 
TLS Online TPP Program

#Question id: 18940

#Part-A Aptitude & General Biotechnology

which of the following permits the amplification of chosen segments of DNA or RNA for detailed study or cloning.
TLS Online TPP Program

#Question id: 24124

#Part-A Aptitude & General Biotechnology

The term “WIPO” stands for:
TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG