If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Question id: 2071

#Part-A Aptitude & General Biotechnology

Diffusion of ions across membranes through specific ion channels is driven by:

#Question id: 2072

#Part-A Aptitude & General Biotechnology

Which of the following structures would decrease the electrochemical gradient across a membrane?

#Question id: 2073

#Part-A Aptitude & General Biotechnology

The phosphate transport system in bacteria imports phosphate into the cell even when the concentration of phosphate outside the cell is much lower than the cytoplasmic phosphate concentration. Phosphate import depends on a pH gradient across the membrane—more acidic outside the cell than inside the cell. In this bacterial cell, phosphate transport is an example of:

#Question id: 2074

#Part-A Aptitude & General Biotechnology

In some cells, there are many ion electrochemical gradients across the plasma membrane even though there are usually only one or two proton pumps present in the membrane. The gradients of the other ions are most likely accounted for by:

#Question id: 2075

#Part-A Aptitude & General Biotechnology

The force driving simple diffusion is:

#Question id: 2076

#Part-A Aptitude & General Biotechnology

An organism with a cell wall would most likely be unable to take in materials through: