If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 13039

#Part-A Aptitude & General Biotechnology

 Which of the following is incorrect about a microarray?

TLS Online TPP Program

#Question id: 11609

#Part-B Specialized Branches in Biotechnology

All of gibberellins are tetracyclic diterpenoid acids, but only a few of which, have intrinsic biologically active gibberellins these are__

TLS Online TPP Program

#Question id: 18886

#Part-A Aptitude & General Biotechnology

What type of microscopy allows for the visualization of internal components within live, unstained specimens?

TLS Online TPP Program

#Question id: 5308

#Part-B Specialized Branches in Biotechnology

What can proteomics reveal that genomics cannot?

TLS Online TPP Program

#Question id: 11196

#Part-B Specialized Branches in Biotechnology

Pyrethroid insecticides prevent the voltage-gated sodium channels of insects from inactivating. Neurons that were exposed to pyrethroids would ________.