TLS Online TPP Program

#Question id: 4211


If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

#Part-A Aptitude & General Biotechnology
  1. 6

  2. 14

  3. 10

  4. 7

More Questions
TLS Online TPP Program

#Question id: 14221

#Part-B Specialized Branches in Biotechnology

E. coli have a maximum respiration rate, qO2max, of about 240-mg O2/g-dry wt-h. It is desired to achieve a cell mass of 20 g dry wt/l. The kLa is 120 h-1 in a 1000-l reactor (800 l working volume). A gas stream enriched in oxygen is used (i.e., 80% O2) which gives a value of C* = 28 mg/L. If oxygen becomes limiting, growth and respiration slow; for example,

                                     
   where CL is the dissolved oxygen concentration in the fermenter. What is CL when the cell mass is  at 20 g/l?

TLS Online TPP Program

#Question id: 14237

#Part-B Specialized Branches in Biotechnology

A genetically-engineered strain of yeast is cultured in a bioreactor at 30⁰C for production of heterologous protein. The oxygen requirement is 80 mmol 1-1 h-I; the critical oxygen concentration is 0.004 mM. The solubility of oxygen in the fermentation broth is estimated to be 10% lower than in water due to solute effects. What is the minimum mass-transfer coefficient necessary to sustain this culture if the reactor is sparged with air at approximately 1 atm pressure ?         

TLS Online TPP Program

#Question id: 14238

#Part-B Specialized Branches in Biotechnology

A genetically-engineered strain of yeast is cultured in a bioreactor at 30⁰C for production of heterologous protein. The oxygen requirement is 80 mmol 1-1 h-I; the critical oxygen concentration is 0.004 mM. The solubility of oxygen in the fermentation broth is estimated to be 10% lower than in water due to solute effects. What mass-transfer coefficient is required if pure oxygen is used instead of air?                       

TLS Online TPP Program

#Question id: 14253

#Part-B Specialized Branches in Biotechnology

Hybridoma cells immobilized on surfaces of Sephadex beads are used in a packed column for production of monoclonoal antibodies (Mab). Hybridoma concentration is approximately X = 5 g/l in the bed. The flow rate of the synthetic medium and glucose concentration are Q = 2 l/h and S0 = 40 g/l, respectively. The rate constant for Mab formation is k = 1 gX/l-d. Assume that there are no diffusion limitations and glucose is the rate limiting nutrient.  Determine the volume of the packed bed for 95% glucose conversion. Bed diameter is D0 = 0.2 m. Neglect the growth of the hybridomas and assume first order kinetics. 

TLS Online TPP Program

#Question id: 14254

#Part-B Specialized Branches in Biotechnology

Hybridoma cells immobilized on surfaces of Sephadex beads are used in a packed column for production of monoclonoal antibodies (Mab). Hybridoma concentration is approximately X = 5 g/l in the bed. The flow rate of the synthetic medium and glucose concentration are Q = 2 l/h and S0 = 40 g/l, respectively. The rate constant for Mab formation is k = 1 gX/l-d. Assume that there are no diffusion limitations and glucose is the rate limiting nutrient.  Determine the height of the packed bed for 95% glucose conversion. Bed diameter is D0 = 0.2 m. Neglect the growth of the hybridomas and assume first order kinetics. 

TLS Online TPP Program

#Question id: 14255

#Part-B Specialized Branches in Biotechnology

Hybridoma cells immobilized on surfaces of Sephadex beads are used in a packed column for production of monoclonoal antibodies (Mab). Hybridoma concentration is approximately X = 5 g/l in the bed. The flow rate of the synthetic medium and glucose concentration are Q = 2 l/h and S0 = 40 g/l, respectively. The rate constant for Mab formation is k = 1 gX/l-d. Assume that there are no diffusion limitations and glucose is the rate limiting nutrient.  If Yp/s is 4 mg Mab/g glu, determine the effluent Mab concentration of the system?