TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 3628
#Part-B Specialized Branches in Biotechnology
Two mutant plants, both bearing white flowers, were crossed. All F1 plants had red colored flowers. Which one of the following conclusions is correct?
TLS Online TPP Program
#Question id: 18907
#Part-A Aptitude & General Biotechnology
When expression of the DNA insert is desired, the vector should contain at least suitable control elements,
TLS Online TPP Program
#Question id: 14118
#Part-B Specialized Branches in Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 10559
#Part-B Specialized Branches in Biotechnology
which gives water a high tensile strength,
TLS Online TPP Program
#Question id: 3023
#Part-B Specialized Branches in Biotechnology
During which phase of the bacterial growth curve does a bacterial population become much more resistant to harmful conditions?