At Dunkin Donuts the number of donut holes in a bag can vary. Help Donald find the mode. 12,10,10,10,13,12,11,13,10

TLS Online TPP Program

#Question id: 3023

#Part-B Specialized Branches in Biotechnology

During which phase of the bacterial growth curve does a bacterial population become much more resistant to harmful conditions?

TLS Online TPP Program

#Question id: 7472

#Part-A Aptitude & General Biotechnology

What will be the angle between the hour and minute hands at 12 : 10?

TLS Online TPP Program

#Question id: 12668

#Part-B Specialized Branches in Biotechnology

What will be the effect of  water deficit condition in the plant cell?

TLS Online TPP Program

#Question id: 4211

#Part-A Aptitude & General Biotechnology

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 2938

#Part-A Aptitude & General Biotechnology

Which of the following inhibit(s) cyclin A/Cdk2 activity?