Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 23147
TLS Online TPP Program

#Question id: 19191

Isothermal amplification is carried out at times. Which of the statement is true?

#Part-A Aptitude & General Biotechnology
  1. The repeated heating and cooling required by PCR is not the reason for limiting how quickly the reaction is carried out
  2. It is carried out typically at 65 degrees
  3. Normal Taq polymerase is used
  4. It requires expensive PCR machines to be carried out
More Questions
TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program

#Question id: 1559

#Part-A Aptitude & General Biotechnology

Which of cytokine is responsible for Class Switch IgM into IgE
TLS Online TPP Program

#Question id: 4497

#Part-B Specialized Branches in Biotechnology

Elongation, termination of transcription, and RNA processing are interconnected, presumably to ensure their proper coordination,

   Elongation factors

I.    hSPT5

To recruit the 5’ -capping enzyme to the CTD tail of polymerase

 II.   TAT-SF1

To recruits components of the splicing machinery to polymerase with a Ser-2 phosphorylated tail

TLS Online TPP Program

#Question id: 2628

#Part-A Aptitude & General Biotechnology

Choose true statement about lac repressor;
TLS Online TPP Program

#Question id: 12069

#Part-B Specialized Branches in Biotechnology

Post-tetanic facilitation is thought to be the result of