#Question id: 672
#Part-A Aptitude & General Biotechnology
An ideal α-helix has a pitch of 0.54 nm and a rise of 0.15 nm. What is the length along the helix axis for a segment of an ideal α-helix that contains 30 amino acids?
#Question id: 19873
#Part-A Aptitude & General Biotechnology
#Question id: 4211
#Part-A Aptitude & General Biotechnology
If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode?
5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’
#Question id: 5703
#Part-B Specialized Branches in Biotechnology
Robertsonian translocation is reciprocal exchange of genetic segment between two acrocentric chromosomes. Which of the following is incorrect statement?
#Question id: 4383
#Part-A Aptitude & General Biotechnology
The mediator complex