Which of the following Assay can measure cell proliferation or cell death or active cells

TLS Online TPP Program

#Question id: 18923

#Part-A Aptitude & General Biotechnology

lacZ' gene present in a Puc series plasmid codes for which of the enzyme?

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 18697

#Part-B Specialized Branches in Biotechnology

Knockout mice are created by

TLS Online TPP Program

#Question id: 5065

#Part-B Specialized Branches in Biotechnology

Binding to the phosphorylated RTK through one of the RTK’s cytoplasmic domains, the adaptor protein also activates Ras. The activated receptor stimulates the adaptor protein to activate the:

TLS Online TPP Program

#Question id: 424

#Part-A Aptitude & General Biotechnology

Phosphorylation at the expense of ATP is catalyzed by ________.