TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#Part-B Specialized Branches in Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 10527

#Part-B Specialized Branches in Biotechnology

Based on their feeding behaviors, three major types of insect herbivores can be distinguished, which evades the constitutive defense;

A) Phloem feeders                                                                    i) caterpillars, grasshoppers, and beetles

B) Cell-content feeders                                                            ii) aphids and whiteflies

C) Chewing insects                                                                    iii) mites and thrips

Correctly match the feeding behaviour with its insects;

TLS Online TPP Program

#Question id: 10528

#Part-B Specialized Branches in Biotechnology

The insect ingests plant tissue containing the fatty acids, an enzyme in the gut conjugates the plant-derived fatty acid to an insect-derived amino acid typically;

TLS Online TPP Program

#Question id: 10529

#Part-B Specialized Branches in Biotechnology

Insects produces an elicitors molecules that is caeliferins at the wound site in Arabidopsis plant, which induces

TLS Online TPP Program

#Question id: 10537

#Part-B Specialized Branches in Biotechnology

Given below some functions of the glutamate receptor-like (GLR) genes. Which one is incorrect?

TLS Online TPP Program

#Question id: 10538

#Part-B Specialized Branches in Biotechnology

Injury to the leaf caused by herbivory activates which types of ion channels?

TLS Online TPP Program

#Question id: 10539

#Part-B Specialized Branches in Biotechnology

All plants releases green-leaf volatiles in response to mechanical damage, this volatile is a mixture of