Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 3017

#Part-A Aptitude & General Biotechnology

Biofilms

TLS Online TPP Program

#Question id: 678

#Part-A Aptitude & General Biotechnology

Which is not true about β-sheets?

TLS Online TPP Program

#Question id: 11547

#Part-B Specialized Branches in Biotechnology

A cluster of tumor cells that produces and secretes growth factors to induce surrounding cells to grow and divide is showing which type of cell-to-cell signaling?

TLS Online TPP Program

#Question id: 905

#Part-B Specialized Branches in Biotechnology

Which of the following is correct about chaperones

A) renature and denatured proteins.

B) help cells repair damage due to heat shock.

C) assist protein self assembly.

D) donot use ATP to fold proteins.

TLS Online TPP Program

#Question id: 14124

#Part-B Specialized Branches in Biotechnology

which of the following database is the first established sequence pattern database?