In E.coli chapronin activity contains  two subunit GroEL and GroES, binding the protein with the GroEL changes the conformations and hydrolysis of ATP would be  takes place. In which conformation of GroEL bound protein to get converted into folded?

TLS Online TPP Program

#Question id: 14115

#Part-A Aptitude & General Biotechnology

Which one of the following is a database of protein sequence motifs?

TLS Online TPP Program

#Question id: 14116

#Part-B Specialized Branches in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 

P. A larger E-value indicates higher sequence similarity 

Q. E-value < 10^-10 indicates sequence homology 

R. A higher BLAST score indicates higher sequence similarity 

S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14116

#Part-A Aptitude & General Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm? 

P. A larger E-value indicates higher sequence similarity 

Q. E-value < 10^-10 indicates sequence homology 

R. A higher BLAST score indicates higher sequence similarity 

S. E-value > 10^10 indicates sequence homology 

TLS Online TPP Program

#Question id: 14117

#Part-B Specialized Branches in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14117

#Part-A Aptitude & General Biotechnology

Identify the character based method used for the construction of a phylogenetic tree. 

P. Maximum parsimony 

Q. Neighbor joining 

R. Maximum likelihood 

S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Part-B Specialized Branches in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG