TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 14118
#Part-B Specialized Branches in Biotechnology
Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG
TLS Online TPP Program
#Question id: 1017
#Part-B Specialized Branches in Biotechnology
The outbreak of measles within the last few years was due to
TLS Online TPP Program
#Question id: 5064
#Part-B Specialized Branches in Biotechnology
Fibroblast growth factors, epidermal growth factors, platelet-derived growth factors, and stem cell factor are all paracrine factors that bind to
TLS Online TPP Program
#Question id: 10340
#Part-B Specialized Branches in Biotechnology
There several charecteristics of nitrate reductase, which of the following properties of nitrate reductase is incorrect?
TLS Online TPP Program
#Question id: 19454
#Part-B Specialized Branches in Biotechnology
Resolving power has the ability to distinguish between