In Leaf Chloroplasts and root plastids contain different forms of the enzyme, nitrite reductase such as

a) Roots contain fd-dependent nitrite reductase

b) Shoots contain NADPH dependent nitrite reductase

c) Shoots contain fd-dependent nitrite reductase

d) Roots contain NADPH dependent nitrite reductase

Which one of the following is correct combination?

TLS Online TPP Program

#Question id: 18751

#Part-A Aptitude & General Biotechnology

What is the half life cycle for Taq polymerase?

TLS Online TPP Program

#Question id: 19463

#Part-A Aptitude & General Biotechnology

DIC microscopy is used for visualizing 

1. Minute details

2. Thick objects

3. Thin objects

4. Larger details

Which among the following options is correct?

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 20596

#Part-B Specialized Branches in Biotechnology

In which one of the following controllers, the response is fast?

TLS Online TPP Program

#Question id: 831

#Part-B Specialized Branches in Biotechnology

Lysosomes therefore also have a selective pathway, which is activated that imports and degrades cytosolic proteins containing the pentapeptide sequences such as;