TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#Part-A Aptitude & General Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 11272

#Part-B Specialized Branches in Biotechnology

Measurement of phytoplankton production, take sample of phytoplankton suspended in three bottles in lake. One bottle as control assumed as initial, second bottle (D) was kept in dark while third bottle (L) was kept in light. After some time productivity measure fallow

A- Difference in dissolved oxygen between light bottle and dark bottle yield NET primary productivity

B- Difference in dissolved oxygen between light bottle and initial bottle yield NET primary productivity

C- Difference in dissolved oxygen between light bottle and initial bottle yield Grass primary productivity

D- Difference in dissolved oxygen between light bottle and dark bottle yield total oxygen produced by photosynthesis

Which above combination of statement are correct?

TLS Online TPP Program

#Question id: 11273

#Part-B Specialized Branches in Biotechnology

Use the following diagram of a hypothetical food web to answer the question. The arrows represent the transfer of energy between the various trophic levels. Which letter represents an organism that could only be a primary consumer and secondary carnivores respectively?




TLS Online TPP Program

#Question id: 11274

#Part-B Specialized Branches in Biotechnology

Assimilation efficiency (AE) is the proportion of ingested energy assimilated in to blood stream but Production efficiency (PE) is the proportion of assimilated energy that is incorporated in to biomass. Following some statement is correct?

A. Assimilation efficiencies of aquatic herbivore is greater than terrestrial herbivore

B. Production efficiencies of higher tropic level are greater than lower tropic level

C. production efficiencies of vertebrate is less than invertebrate

D. Assimilation efficiencies of Carnivore are often greater than herbivore

TLS Online TPP Program

#Question id: 11275

#Part-B Specialized Branches in Biotechnology

Consumption efficiency is the proportion of production at one trophic level that is eaten by, or ingested, by the next trophic level which of the following are correct statement ?

A.Consumption efficiencies higher in  forests than grassland

B-In aquatic ecosystems consuption efficiencies of hervivore are greater than terrestrial hervivore

C- Consumption efficiencies for carnivores are typically higher than those of herbivores

D-Primary production consumption is increased where it is high in nutrients such as nitrogen and phosphorus

TLS Online TPP Program

#Question id: 11276

#Part-B Specialized Branches in Biotechnology

Following statement regarding efficiency at different tropic level for secondary production?

A-high production efficiency individual able to survive at little food

B-production efficiency decrease toward increase tropic level 

C-aquatic herbivore is more efficient grazer than terrestrial grazer

D- Carnivore assimilation efficiency appear to average around 10%

Which above combination are correct?

TLS Online TPP Program

#Question id: 11277

#Part-B Specialized Branches in Biotechnology

If a species is a keystone predator, then its removal from a community should

(A) Increase population size of the predator’s preferred prey

(B) decrease species diversity in the prey community

(C) decrease productivity of the predator’s preferred prey

(D) increase species diversity in the prey community