Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 659

#Part-A Aptitude & General Biotechnology

What does it mean to say a protein is oligomeric?

TLS Online TPP Program

#Question id: 423

#Part-B Specialized Branches in Biotechnology

The glycolytic pathway oxidizes glucose to two molecules of pyruvate and also produces a net of two molecules of ATP. ATP allosterically inhibits the enzyme, PFK-1, that catalyzes the third step of glycolysis. This is an example of ________.

TLS Online TPP Program

#Question id: 10279

#Part-B Specialized Branches in Biotechnology

Phosphohexose isomerase is one of the enzyme of glycolysis which catalyzes Glucose 6-phosphate to Fructose 6-phosphate, enzyme bind with the hexose in their active site by opening the structure. The ring opening and closing reactions are catalyzed by an active-site present amino acid such as

TLS Online TPP Program

#Question id: 2943

#Part-A Aptitude & General Biotechnology

Which of the following is NOT a mechanism by which G1/S cyclin-CDKs ensure progression through the cell cycle?

TLS Online TPP Program

#Question id: 18844

#Part-A Aptitude & General Biotechnology

In the extraction of DNA from cell with to remove the high protein content from the cell , before phenol treatment which of the following treatment is done