Which of the following enzyme is used to cut DNA molecules in rDNA technology

TLS Online TPP Program

#Question id: 19007

#Part-A Aptitude & General Biotechnology

For the separation of which of the following substances, Gas-solid chromatography is being used?

TLS Online TPP Program

#Question id: 19531

#Part-B Specialized Branches in Biotechnology

According to the Balances on steady-state processes, the accumulation is equal to?

TLS Online TPP Program

#Question id: 5708

#Part-B Specialized Branches in Biotechnology

If non-disjunction occurs in meiosis I, which of the following scenario is most likely to occur?

TLS Online TPP Program

#Question id: 14118

#Part-A Aptitude & General Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 12757

#Part-A Aptitude & General Biotechnology

Biomanipulation can best be described as