follicular dendritic cells (FDCs) secrete CXCL13 and its receptor, CXCR5, which is expressed on B cells, function of this interaction ?

TLS Online TPP Program

#Question id: 10357

#Part-B Specialized Branches in Biotechnology

Why the glutamine and glutamate will not be transported while  asparagine will prefer to be transported?

TLS Online TPP Program

#Question id: 12672

#Part-B Specialized Branches in Biotechnology

Following are given some prediction about stress response which ultimately generate ROS;

a) Stress response activates the scavenging mechanism by ROS , these ROS is responsible for activating self-generation  mechanism by using RBOH

b) ROS have a negative effect on plant growth,  development,  and  yield

c) Almost every stress leads to the activation of ROS and its signal transduction

d) ROS indirectly induce acclimation mechanisms

Which of the following is the correct prediction about ROS activated by stress response?

TLS Online TPP Program

#Question id: 10290

#Part-A Aptitude & General Biotechnology

In glycolysis, perform succesfully ten step reaction, the conversion of 1 molecules of glucose 6-phosphate to 2 molecules of Pyruvate. What is the net gain of overall reaction?

TLS Online TPP Program

#Question id: 4211

#Part-A Aptitude & General Biotechnology

If the following eukaryotic mRNA were properly modified and sent to the cytoplasm, what size protein (in amino acids) would it encode? 

5’UCAGGACCUUAUGGACCAUUGCUGGGACCUUUGAGUGCUGUACCAUAGUUAAAGAUAGCCAUC 3’

TLS Online TPP Program

#Question id: 2952

#Part-A Aptitude & General Biotechnology

Throughout interphase,.. .........  are synthesized at a relatively constant rate, whereas  ............ are synthesized only during the S phase.