Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14682

#Section 1: Engineering Mathematics

The Taylor series for f(x) = 2x² +4x - 3 about 1 is

TLS Online TPP Program

#Question id: 3615

#Section 3: Genetics, Cellular and Molecular Biology

What are alleles?

TLS Online TPP Program

#Question id: 21013

#Section 4: Fundamentals of Biological Engineering

The degree of reduction of glucose is-

TLS Online TPP Program

#Question id: 3880

#Section 3: Genetics, Cellular and Molecular Biology

Which one of the following properties of the L-19 IVS ribozyme is not shared with enzymes that are purely protein?

TLS Online TPP Program

#Question id: 1563

#Section 2: General Biology

A nonfunctional CD4 protein on a helper T cell would result in the helper T cell being unable to ________.