TLS Online TPP Program

#Question id: 14118


Identify the file format given below:
>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds
GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG
AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT
CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
  1. NBRF
  2. FASTA
  3. GenBank
  4. EMBL
More Questions
TLS Online TPP Program

#Question id: 10268

#Section 3: Genetics, Cellular and Molecular Biology

In cats, black coat color is dominant over gray. A female black cat whose mother is gray mates with a gray male. If this female has a litter of six kittens, what is the probability that three will be black?

TLS Online TPP Program

#Question id: 10269

#Section 3: Genetics, Cellular and Molecular Biology

If the probability of being blood-type A is 1/8 and the probability of being blood-type O is 1/2, what is the probability of being either blood-type A or blood-type O?

TLS Online TPP Program

#Question id: 10272

#Section 3: Genetics, Cellular and Molecular Biology

Specific place on a chromosome occupied by an allele

TLS Online TPP Program

#Question id: 10405

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

In some cases phytochrome itself moves to the nucleus in a light-dependent manner. Detection of this movement relied on the ability to fuse phytochrome with,

TLS Online TPP Program

#Question id: 10501

#Section 6: Plant, Animal and Microbial Biotechnology

Which defenses require specific detection systems and signal transduction pathways that can sense the presence of an herbivore or pathogen and alter gene expression and metabolism accordingly

TLS Online TPP Program

#Question id: 10502

#Section 6: Plant, Animal and Microbial Biotechnology

Arabidopsis roots in iron-deficient growth media, thereby facilitating increased iron uptake. The resulting increase in iron content of the plants by