Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 1489

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

How might you distinguish between a malignant tumor and a benign tumor?

TLS Online TPP Program

#Question id: 1539

#Section 2: General Biology

Regulatory T cell (TREG) have identified by the presence of

TLS Online TPP Program

#Question id: 1540

#Section 2: General Biology

Peptidoglycans  recognize by

TLS Online TPP Program

#Question id: 1541

#Section 2: General Biology

Nonphagocytic cell of immune system,

TLS Online TPP Program

#Question id: 1543

#Section 3: Genetics, Cellular and Molecular Biology

Effector  cytokines of TH 1 cells?

TLS Online TPP Program

#Question id: 1543

#Section 2: General Biology

Effector  cytokines of TH 1 cells?