The kLa of a small bubble column (2 l) has been measured as 20 h-1 at an airflow of 4 l/m in. If the rate of oxygen uptake by a culture of Catharanthus roseus is 0.2 mmol O2/g dry weight-h and if the critical oxygen concentration must be above 10% of saturation (about 8 mg/l), what is the maximum concentration of cells that can be maintained in the reactor?

TLS Online TPP Program

#Question id: 1662

#Section 2: General Biology

What is the approximate number of D segment genes in the immunoglobulin heavy chain gene locus?

TLS Online TPP Program

#Question id: 13095

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

 (a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

Find the correct band pattern in gel lanes what size(s) of PCR products you would get if you used the following primers stated in parts (a), (b), and (c) to do a PCR reaction on the template DNA shown above.

TLS Online TPP Program

#Question id: 3715

#Section 3: Genetics, Cellular and Molecular Biology

DNA polymerase III requires a/an ________ for synthesis of DNA to occur.

TLS Online TPP Program

#Question id: 18633

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Phylogenetic tree provides information about 

TLS Online TPP Program

#Question id: 3350

#Section 3: Genetics, Cellular and Molecular Biology

In a given population, 128 out of every 400 people has a carrier for recessive allele b that caused cancer in homozygous condition,  Assuming the population is in Hardy- Weinberg equilibrium, which of the following is the expected frequency of allele B and b in population respectively?