Which is not correctly match, effect of process variables on mass transfer characteristics?

Process variable                     mass transfer characteristics

P. P/V                              -          oxygen transfer rate

q. Impeller tip speed     -          mixing time

r. Reynolds                     -          number shear rate 

TLS Online TPP Program

#Question id: 10768

#Section 3: Genetics, Cellular and Molecular Biology

Dihybrid test cross genotypic and phenotypic ratio is

TLS Online TPP Program

#Question id: 13101

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.

 

You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence

 

5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’

You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’

This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:

N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C

You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.

What is the % identity between the two protein sequences?

TLS Online TPP Program

#Question id: 14143

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

The higher is the score in the alignment _________

TLS Online TPP Program

#Question id: 14669

#Section 4: Fundamentals of Biological Engineering

What is the potential energy in (ft)(lb_f) of a 100 lb drum hanging 10 ft above the surface of the Earth with reference to the surface of the Earth?

TLS Online TPP Program

#Question id: 18711

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

SYBR green qPCR based on