Practice Questions

TLS Online TPP Program

#Question id: 3748

How are the BRCA proteins and their genes implicated in breast cancer?

#Section 3: Genetics, Cellular and Molecular Biology

The BRCA proteins damage DNA by generating double-stranded breaks which can lead to cancer.
Cells become more susceptible to damage if the genes for these proteins are damaged.
BRCA proteins inhibit excision repair mechanisms.
BRCA proteins initiate recombination between non-homologous DNA sequences.

More Questions

TLS Online TPP Program

#Question id: 15874

#Section 6: Plant, Animal and Microbial Biotechnology

Callus culture show numerical chromosomal changes such as;

TLS Online TPP Program

#Question id: 16791

#Section 1: Engineering Mathematics

The mode of a distribution is 24 and the mean is 60. What is its median?

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14430

#Section 5: Bioprocess Engineering and Process Biotechnology

Which is not correctly match, effect of process variables on mass transfer characteristics?

Process variable mass transfer characteristics

P. P/V - oxygen transfer rate

q. Impeller tip speed - mixing time

r. Reynolds - number shear rate

TLS Online TPP Program

#Question id: 14183

#Section 5: Bioprocess Engineering and Process Biotechnology

Aerobic degradation of benzoic acid by a mixed culture of microorganisms can be represented by the following reaction.

Determine degree of reduction for the substrate.

______________