The link between an activated amino acid and tRNA is an __ bond between the __ of the amino acid and a hydroxyl group of the tRNA.

TLS Online TPP Program

#Question id: 13096

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 14544

#Section 1: Engineering Mathematics

Determine the value of ‘a’ and ‘b’ so that f (x) is continuous.

TLS Online TPP Program

#Question id: 20013

#Section 5: Bioprocess Engineering and Process Biotechnology

In fed batch bioreactor modelling, the rate of change in the bioreactor volume is assumed to be equal to

TLS Online TPP Program

#Question id: 15428

#Section 1: Engineering Mathematics

Solution of (D³ - D) y = 0 is 

TLS Online TPP Program

#Question id: 14494

#Section 1: Engineering Mathematics

A card is drawn from a pack of 52 cards and then a second is drawn. Probability that both the cards drawn are queen is