Practice Questions

TLS Online TPP Program

#Question id: 10144

Choose the incorrect statements about photosynthesis dark reaction ?

#Section 2: General Biology

The light dependent enzymes which are activated by Ferredoxin–thioredoxin system, contain oxidised di-sulfide bonds (—S—S—) in its active form
C3 cycle or Calvin–Benson cycle is regulated by Photosystem I
The activation of enzymes of the Calvin– Benson cycle starts in the light with the reduction of ferredoxin by the photosynthetic electron transport chain (Chl)
The series of Ferredoxin–thioredoxin system in presence of light is, 2 Ferredoxin (oxidized) to 2 Ferredoxin (reduced)→ Trx(s−s) to Trx(SH) → Ferredoxin– thioredoxin reductase (s−s) to Ferredoxin– thioredoxin reductase(SH)→ Enzyme (inactive)(s−s) to Enzyme (active)(SH)

More Questions

TLS Online TPP Program

#Question id: 14116

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following statements are CORRECT when a protein sequence database is searched using the BLAST algorithm?

P. A larger E-value indicates higher sequence similarity

Q. E-value < 10^-10 indicates sequence homology

R. A higher BLAST score indicates higher sequence similarity

S. E-value > 10^10 indicates sequence homology

TLS Online TPP Program

#Question id: 14117

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the character based method used for the construction of a phylogenetic tree.

P. Maximum parsimony

Q. Neighbor joining

R. Maximum likelihood

S. Bootstrapping

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 14119

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is incorrect regarding sequence homology?

TLS Online TPP Program

#Question id: 14120

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is not a variant of BLAST?

TLS Online TPP Program

#Question id: 14121

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Which of the following is not the classification of SCOP?