if the forward ( p in to q) and reverse ( q in to p) mutation rates for alleles at a locus are 1×10−1 and 1×10−2 per generation, respectively and the allelic frequencies are p = 0.20 and q = 0.80. if you assuming random matting population. Which of the following observation correct?

TLS Online TPP Program

#Question id: 15399

#Section 1: Engineering Mathematics

If I(s) = 3s/ (s+1)(s+4), then i(t) is 

TLS Online TPP Program

#Question id: 14415

#Section 2: General Biology

Which of the following physical sterilization processes can denature proteins?

1. Boiling

2. Autoclaving

3. Pasteurization

4. Refrigeration

5. Ionizing

Choose the incorrect combination.

TLS Online TPP Program

#Question id: 13096

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below.

 

 

(a) 5’-ACTTCGATATGTCTAAAATAC-3’ and 5’- CGGTAGCGTCTCTGGTTAGCT -3’

(b) 5’-TGAAGCTATACAGATTTTATG-3’ and 5’-GCCATCGCAGAGACCAATCGA-3’

(c) 5’-GTATTTTAGACATATCGAAGT -3’ and 5’-AGCTAACCAGAGACGCTACCG-3’

You are asked to design a 15-nucleotide-long primer that could potentially hybridize to a portion of a specific mRNA that encodes the protein sequence N-Met-Ala-Tyr-Trp-Pro-C. How many different primers would you have to design in order to ensure that one of them will in fact hybridize along its full length to the mRNA?

TLS Online TPP Program

#Question id: 15137

#Section 6: Plant, Animal and Microbial Biotechnology

Most mitochondrial proteins however, are manufactured under the direction of the nucleus. Mitochondria reproduce by 

TLS Online TPP Program

#Question id: 1142

#Section 3: Genetics, Cellular and Molecular Biology

Of the components of a heterotrimeric G protein, which subunit(s) is(are) able to activate downstream responses?