TLS Online TPP Program
More Questions
TLS Online TPP Program
#Question id: 3551
#Section 3: Genetics, Cellular and Molecular Biology
In angiosperm plant, assume that the male parent has an AA Bb genotype, and that the female parent has an aa BB genotype. What is genotype in endosperm nucleus, after reproduction between these two plants?
TLS Online TPP Program
#Question id: 27323
#Section 5: Bioprocess Engineering and Process Biotechnology
In microbial cultivation experiment with cells having significant maintenance requirements, the measured growth yield Y’ XS (G) and the true growth yield Y XS
TLS Online TPP Program
#Question id: 14236
#Section 5: Bioprocess Engineering and Process Biotechnology
Nutrient medium is to be heated from 10⁰C to 28⁰C is a single-pass countercurrent shell-and-tube heat exchanger before being pumped into a fed-batch fermenter. Medium passes through the tubes of the exchanger; the shell-side fluid is water which enters with flow rate 3 x 10^4 kg h^- 1 and temperature 60⁰C pre-heated medium is required at a rate of 50 m^3 h^-1. The density, viscosity and heat capacity of the medium are the same as water; the thermal conductivity of the medium is 0.54 Wm^- 1 ⁰C ^- 1. It is proposed to use 30 steel tubes with inner diameter 5 cm; the tubes will be arranged in line. The pipe wall is 5-mm thick; the thermal conductivity of the metal is 50 Wm^- 1 ⁰C^ - 1. The maximum linear shell-side fluid velocity is estimated as 0.15 m s^-1. What tube length is required? ____________
TLS Online TPP Program
#Question id: 10538
#Section 6: Plant, Animal and Microbial Biotechnology
Injury to the leaf caused by herbivory activates which types of ion channels?
TLS Online TPP Program
#Question id: 13100
#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein:
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?