Let a number 30 be divided into two parts such that cube of one multiplied with the other is maximum, then the parts are

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 2067

#Section 3: Genetics, Cellular and Molecular Biology

Which of the following would likely diffuse through the lipid bilayer of a plasma membrane most rapidly?

TLS Online TPP Program

#Question id: 15257

#Section 6: Plant, Animal and Microbial Biotechnology

complex media often are needed because the nutritional requirements of a particular microorganism are

TLS Online TPP Program

#Question id: 1646

#Section 2: General Biology

The basic immunoglobulin (Ig) unit is composed of:

TLS Online TPP Program

#Question id: 1583

#Section 2: General Biology

These cells are involved in cell-mediated immunity and destroy virally infected cells: