Practice Questions

  1. Home
  2. Free Resources
  3. Practice Questions
  4. 12742
TLS Online TPP Program

#Question id: 3025

Penicillin is an antibiotic that inhibits enzymes from catalyzing the synthesis of peptidoglycan, so which prokaryotes should be most vulnerable to inhibition by penicillin?

#Section 2: General Biology

  1. mycoplasmas

  2. gram-positive bacteria

  3. archaea

  4. gram-negative bacteria

More Questions
TLS Online TPP Program

#Question id: 14583

#Section 2: General Biology

Products that limit pH changes are often incorporated into media and are referred to as
TLS Online TPP Program

#Question id: 14247

#Section 5: Bioprocess Engineering and Process Biotechnology

A steam steriliser is used to sterilise liquid medium for fermentation. The initial concentration of contaminating organisms is 108 per litre. For design purposes, the final acceptable level of contamination is usually taken to be 10-3cells; this corresponds to a risk that one batch in a thousand will remain contaminated even after the sterilisation process is complete. For how long should 1 m3 medium be treated if the temperature is 121⁰C ________________.

 To be safe, assume that the contaminants present are spores of Bacillus stearothermophilus, one of the most heat-resistant microorganisms known. For these spores the activation energy for thermal death is 283 kJ gmo1-1 and the Arrhenius constant is 1036.2 s-1

TLS Online TPP Program

#Question id: 13100

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?
TLS Online TPP Program

#Question id: 3671

#Section 3: Genetics, Cellular and Molecular Biology

_____________ promotes recombination between specific sites on the plasmid if the same site occurs more than once in the molecule, as it would in a dimer or multimer.
TLS Online TPP Program

#Question id: 403

#Section 4: Fundamentals of Biological Engineering

For the reaction A -> B, DG'° = –60 kJ/mol.  The reaction is started with 10 mmol of A; no B is initially present.  After 24 hours, analysis reveals the presence of 2 mmol of B, 8 mmol of A. Which is the most likely explanation?