TLS Online TPP Program

#Question id: 19138


Which of the following statement is correct?

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology
  1. BLOSUM matrices may have less evolutionary meaning than the PAM matrices. 
  2. BLOSUM matrices are entirely derived from local sequence alignments of conserved sequence blocks, whereas the PAM1 matrix is based on the global alignment of full-length sequences
  3. PAM matrices are derived from an evolutionary model whereas the BLOSUM matrices consist of entirely direct observations
  4. All of the above 
More Questions
TLS Online TPP Program

#Question id: 13100

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

 You are a scientist who is using genomics to currently study a new bacterial species that no one has ever studied before. The following sequence is a piece of DNA within the coding region of a gene that you have recently sequenced.
 
You are using shotgun sequencing to determine the DNA sequence of the genome of this new bacterial species. For one strand of a 30-nucleotide long stretch of DNA, you get the following sequences out of your shotgun sequencing reaction. Assemble the entire 30-nt-long DNA sequence
  
5’-TGGGAGTTCCTCAAACGCGTTGTCACTGAC-3’
You put the DNA sequence that you have assembled into a computer program that tells you that the following piece of DNA, which comes from another bacterium, is a close match to the sequence you have sequenced from your bacterium: 5’-…TGGGCATTTCTCAAGCGGGTTGTAATGGAT…-3’
This 30-nt-long sequence fragment lies in the center of a gene, and that portion of the sequence encodes for this 10-amino acid-long part of a protein: 
N-…Trp-Ala-Phe-Leu-Lys-Arg-Val-Val-Met-Asp…-C
You hypothesize that the sequence you have discovered is another bacterial species’ version of the same gene as this previously known gene. To measure how identical the two genes are at the DNA level and/or the two proteins are at the amino acid level, you can calculate a percentage of “identity” for each. This is the percent of nucleotides (for the gene) or the percent of amino acids (for the protein) that are identical between the two sequences.
What is the % identity between the two DNA sequences?

TLS Online TPP Program

#Question id: 1613

#Section 2: General Biology

Complement component C3 is cleaved by:

TLS Online TPP Program

#Question id: 3920

#Section 3: Genetics, Cellular and Molecular Biology

The genes that encode proteins are transcribed by RNA polymerase __.

TLS Online TPP Program

#Question id: 14253

#Section 5: Bioprocess Engineering and Process Biotechnology

Hybridoma cells immobilized on surfaces of Sephadex beads are used in a packed column for production of monoclonoal antibodies (Mab). Hybridoma concentration is approximately X = 5 g/l in the bed. The flow rate of the synthetic medium and glucose concentration are Q = 2 l/h and S0 = 40 g/l, respectively. The rate constant for Mab formation is k = 1 gX/l-d. Assume that there are no diffusion limitations and glucose is the rate limiting nutrient.  Determine the volume of the packed bed for 95% glucose conversion. Bed diameter is D0 = 0.2 m. Neglect the growth of the hybridomas and assume first order kinetics. 

TLS Online TPP Program

#Question id: 8921

#Section 6: Plant, Animal and Microbial Biotechnology

Evidence of which structure or characteristic would be most surprising to find among fossils of the Ediacaran fauna?