What is the molarity of 245.0 g of H₂SO₄ dissolved in 1.000 L of solution?

TLS Online TPP Program

#Question id: 3625

#Section 3: Genetics, Cellular and Molecular Biology

If a heterozygous two recessive mutation at different site will give mutant phenotype when gene involved

TLS Online TPP Program

#Question id: 14118

#Section 7: Recombinant DNA technology and Other Tools in Biotechnology

Identify the file format given below:

>KX580312.1 Homo sapiens truncated breast cancer 1 (BRCA1) gene, exon 15 and partial cds

GTCATCCCCTTCTAAATGCCCATCATTAGATGATAGGTGGTACATGCACAGTTGCTCTGGGAGTCTTCAG

AATAGAAACTACCCATCTCAAGAGGAGCTCATTAAGGTTGTTGATGTGGAGGAGTAACAGCTGGAAGAGT

CTGGGCCACACGATTTGACGGAAACATCTTACTTGCCAAGGCAAGATCTAG

TLS Online TPP Program

#Question id: 4346

#Section 3: Genetics, Cellular and Molecular Biology

Which of the following results would occur if the repressor of an inducible operon were mutated so that it could not bind the operator?

TLS Online TPP Program

#Question id: 1844

#Section 2: General Biology

Which of the following diseases has been completely eradicated worldwide?

TLS Online TPP Program

#Question id: 2074

#Section 2: General Biology

In some cells, there are many ion electrochemical gradients across the plasma membrane even though there are usually only one or two proton pumps present in the membrane. The gradients of the other ions are most likely accounted for by: